Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503338604:

Variant ID: vg0503338604 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3338604
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCGGTCATGTTCTTTTCTGATTAAAATTCAGATATTACCTCTGTTCGTATTAGCGTGCTTTTTAAACAACTAAACGATACGTTACAGAAACTTTTTATA[C/T]
AGAAGTTGCTTTAAACTATCAGATATATCAATTTATCAGTTAGCAATAATTAAAACTTAGTTAATCATGTTTACTAGCCTTAGTGTTTTTGTATGGATTT

Reverse complement sequence

AAATCCATACAAAAACACTAAGGCTAGTAAACATGATTAACTAAGTTTTAATTATTGCTAACTGATAAATTGATATATCTGATAGTTTAAAGCAACTTCT[G/A]
TATAAAAAGTTTCTGTAACGTATCGTTTAGTTGTTTAAAAAGCACGCTAATACGAACAGAGGTAATATCTGAATTTTAATCAGAAAAGAACATGACCGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	9.10%	0.21%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	78.20%	21.20%	0.60%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	82.00%	17.10%	0.91%	0.00%	NA
Tropical Japonica	504	85.70%	14.30%	0.00%	0.00%	NA
Japonica Intermediate	241	50.60%	48.50%	0.83%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503338604	C -> T	LOC_Os05g06490.1	upstream_gene_variant ; 3450.0bp to feature; MODIFIER	silent_mutation	Average:40.695; most accessible tissue: Callus, score: 61.713	N	N	N	N
vg0503338604	C -> T	LOC_Os05g06470.1	downstream_gene_variant ; 3755.0bp to feature; MODIFIER	silent_mutation	Average:40.695; most accessible tissue: Callus, score: 61.713	N	N	N	N
vg0503338604	C -> T	LOC_Os05g06480.1	intron_variant ; MODIFIER	silent_mutation	Average:40.695; most accessible tissue: Callus, score: 61.713	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503338604	NA	8.79E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	5.08E-06	mr1041	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	8.04E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	1.82E-07	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	2.54E-06	2.53E-06	mr1885	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	2.09E-09	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	5.22E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	3.43E-06	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503338604	NA	3.25E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251