\
| Variant ID: vg0503338604 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3338604 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCGGTCATGTTCTTTTCTGATTAAAATTCAGATATTACCTCTGTTCGTATTAGCGTGCTTTTTAAACAACTAAACGATACGTTACAGAAACTTTTTATA[C/T]
AGAAGTTGCTTTAAACTATCAGATATATCAATTTATCAGTTAGCAATAATTAAAACTTAGTTAATCATGTTTACTAGCCTTAGTGTTTTTGTATGGATTT
AAATCCATACAAAAACACTAAGGCTAGTAAACATGATTAACTAAGTTTTAATTATTGCTAACTGATAAATTGATATATCTGATAGTTTAAAGCAACTTCT[G/A]
TATAAAAAGTTTCTGTAACGTATCGTTTAGTTGTTTAAAAAGCACGCTAATACGAACAGAGGTAATATCTGAATTTTAATCAGAAAAGAACATGACCGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 9.10% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 78.20% | 21.20% | 0.60% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 82.00% | 17.10% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 48.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503338604 | C -> T | LOC_Os05g06490.1 | upstream_gene_variant ; 3450.0bp to feature; MODIFIER | silent_mutation | Average:40.695; most accessible tissue: Callus, score: 61.713 | N | N | N | N |
| vg0503338604 | C -> T | LOC_Os05g06470.1 | downstream_gene_variant ; 3755.0bp to feature; MODIFIER | silent_mutation | Average:40.695; most accessible tissue: Callus, score: 61.713 | N | N | N | N |
| vg0503338604 | C -> T | LOC_Os05g06480.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.695; most accessible tissue: Callus, score: 61.713 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503338604 | NA | 8.79E-06 | mr1010 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 5.08E-06 | mr1041 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 8.04E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 1.82E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | 2.54E-06 | 2.53E-06 | mr1885 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 2.09E-09 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 5.22E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 3.43E-06 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503338604 | NA | 3.25E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |