\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503163550:

Variant ID: vg0503163550 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3163550
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATGTGACAGATTACAAAAATTCCATCATTTGTTTTCCCAAAATACCCTTGTACTACACCATACTACATGGGTATACTACCTATACTAAGGCTGTGTT[C/A]
GTGTGTTCGTTCCAGGGACATTGGGTGAGAAAGCTCCTCGTTTTCCGTGCGCACGCTTCCCAAACTACTAAACGGTGCGTTTTTTGCAAAAAATTTCTAT

Reverse complement sequence

ATAGAAATTTTTTGCAAAAAACGCACCGTTTAGTAGTTTGGGAAGCGTGCGCACGGAAAACGAGGAGCTTTCTCACCCAATGTCCCTGGAACGAACACAC[G/T]
AACACAGCCTTAGTATAGGTAGTATACCCATGTAGTATGGTGTAGTACAAGGGTATTTTGGGAAAACAAATGATGGAATTTTTGTAATCTGTCACATGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.00% 7.60% 0.25% 66.14% NA
All Indica  2759 1.60% 1.20% 0.07% 97.17% NA
All Japonica  1512 73.80% 21.00% 0.46% 4.76% NA
Aus  269 5.60% 0.00% 0.00% 94.42% NA
Indica I  595 0.50% 0.00% 0.00% 99.50% NA
Indica II  465 4.10% 0.40% 0.00% 95.48% NA
Indica III  913 0.70% 2.70% 0.11% 96.50% NA
Indica Intermediate  786 1.90% 0.80% 0.13% 97.20% NA
Temperate Japonica  767 69.90% 27.10% 0.52% 2.48% NA
Tropical Japonica  504 83.30% 11.50% 0.40% 4.76% NA
Japonica Intermediate  241 66.40% 21.20% 0.41% 12.03% NA
VI/Aromatic  96 17.70% 0.00% 0.00% 82.29% NA
Intermediate  90 43.30% 8.90% 3.33% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503163550 C -> DEL N N silent_mutation Average:32.228; most accessible tissue: Callus, score: 66.326 N N N N
vg0503163550 C -> A LOC_Os05g06240-LOC_Os05g06250 intergenic_region ; MODIFIER silent_mutation Average:32.228; most accessible tissue: Callus, score: 66.326 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503163550 NA 6.68E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 1.50E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 3.97E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 3.74E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 7.28E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 4.53E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 5.69E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 1.49E-06 8.01E-09 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503163550 NA 1.31E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251