Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503080037:

Variant ID: vg0503080037 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3080037
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AGCGGGCTACAGATATGTAGTCAGCTGCAACACGGACTTCAAGACGTAATGTGTATATGACAGGTGGGACCAGATATTAATAGTATAGTAAGCAACTATT[G/A]
TATAAATTAGTTATTACATTGGCTATAGATGATTTAGAGCTAGTAGTGGGCTATATTATTAAACTTGCTATTACCACATCAACACGCACTTCTCGTTCAC

Reverse complement sequence

GTGAACGAGAAGTGCGTGTTGATGTGGTAATAGCAAGTTTAATAATATAGCCCACTACTAGCTCTAAATCATCTATAGCCAATGTAATAACTAATTTATA[C/T]
AATAGTTGCTTACTATACTATTAATATCTGGTCCCACCTGTCATATACACATTACGTCTTGAAGTCCGTGTTGCAGCTGACTACATATCTGTAGCCCGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	40.90%	0.30%	0.00%	NA
All Indica	2759	37.50%	62.00%	0.51%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.00%	0.00%	NA
Aus	269	38.30%	61.70%	0.00%	0.00%	NA
Indica I	595	69.20%	30.80%	0.00%	0.00%	NA
Indica II	465	45.60%	53.80%	0.65%	0.00%	NA
Indica III	913	17.30%	82.00%	0.66%	0.00%	NA
Indica Intermediate	786	32.20%	67.20%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503080037	G -> A	LOC_Os05g06150.1	upstream_gene_variant ; 3770.0bp to feature; MODIFIER	silent_mutation	Average:52.45; most accessible tissue: Minghui63 root, score: 78.594	N	N	N	N
vg0503080037	G -> A	LOC_Os05g06140-LOC_Os05g06150	intergenic_region ; MODIFIER	silent_mutation	Average:52.45; most accessible tissue: Minghui63 root, score: 78.594	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503080037	NA	1.27E-08	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	NA	8.24E-06	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	NA	4.36E-10	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	NA	6.69E-08	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	3.19E-06	1.30E-07	mr1452_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	NA	5.19E-06	mr1530_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	NA	4.23E-08	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037	NA	9.62E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251