\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503080037:

Variant ID: vg0503080037 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3080037
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGGGCTACAGATATGTAGTCAGCTGCAACACGGACTTCAAGACGTAATGTGTATATGACAGGTGGGACCAGATATTAATAGTATAGTAAGCAACTATT[G/A]
TATAAATTAGTTATTACATTGGCTATAGATGATTTAGAGCTAGTAGTGGGCTATATTATTAAACTTGCTATTACCACATCAACACGCACTTCTCGTTCAC

Reverse complement sequence

GTGAACGAGAAGTGCGTGTTGATGTGGTAATAGCAAGTTTAATAATATAGCCCACTACTAGCTCTAAATCATCTATAGCCAATGTAATAACTAATTTATA[C/T]
AATAGTTGCTTACTATACTATTAATATCTGGTCCCACCTGTCATATACACATTACGTCTTGAAGTCCGTGTTGCAGCTGACTACATATCTGTAGCCCGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.90% 0.30% 0.00% NA
All Indica  2759 37.50% 62.00% 0.51% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 69.20% 30.80% 0.00% 0.00% NA
Indica II  465 45.60% 53.80% 0.65% 0.00% NA
Indica III  913 17.30% 82.00% 0.66% 0.00% NA
Indica Intermediate  786 32.20% 67.20% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503080037 G -> A LOC_Os05g06150.1 upstream_gene_variant ; 3770.0bp to feature; MODIFIER silent_mutation Average:52.45; most accessible tissue: Minghui63 root, score: 78.594 N N N N
vg0503080037 G -> A LOC_Os05g06140-LOC_Os05g06150 intergenic_region ; MODIFIER silent_mutation Average:52.45; most accessible tissue: Minghui63 root, score: 78.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503080037 NA 1.27E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 NA 8.24E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 NA 4.36E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 NA 6.69E-08 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 3.19E-06 1.30E-07 mr1452_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 NA 5.19E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 NA 4.23E-08 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503080037 NA 9.62E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251