\
| Variant ID: vg0503041446 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3041446 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 182. )
GTTGTGAGCCATCCAAACTCACATATTTTAAATTCCCATGTTTCAGATTTACGTGGGACATTGGCTAGGGGAACGATGCTAATGCCATTAGTGCCGTTAT[G/A]
TTGTTGCATGATACCAATGACGTTGGCTCCACGAAAAGGGTTCATTACTAGAATAATATTTCTAGATGTCTATTTATGAAATAAGTTTTCAAAAAGGGTC
GACCCTTTTTGAAAACTTATTTCATAAATAGACATCTAGAAATATTATTCTAGTAATGAACCCTTTTCGTGGAGCCAACGTCATTGGTATCATGCAACAA[C/T]
ATAACGGCACTAATGGCATTAGCATCGTTCCCCTAGCCAATGTCCCACGTAAATCTGAAACATGGGAATTTAAAATATGTGAGTTTGGATGGCTCACAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 38.50% | 0.11% | 0.74% | NA |
| All Indica | 2759 | 96.60% | 2.20% | 0.18% | 0.94% | NA |
| All Japonica | 1512 | 2.20% | 97.20% | 0.00% | 0.60% | NA |
| Aus | 269 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.20% | 1.00% | 0.33% | 2.52% | NA |
| Indica Intermediate | 786 | 95.80% | 3.70% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 97.20% | 0.00% | 1.79% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 17.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503041446 | G -> DEL | N | N | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| vg0503041446 | G -> A | LOC_Os05g06080.1 | upstream_gene_variant ; 712.0bp to feature; MODIFIER | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| vg0503041446 | G -> A | LOC_Os05g06090.1 | upstream_gene_variant ; 2940.0bp to feature; MODIFIER | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| vg0503041446 | G -> A | LOC_Os05g06100.1 | upstream_gene_variant ; 4476.0bp to feature; MODIFIER | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| vg0503041446 | G -> A | LOC_Os05g06060.1 | downstream_gene_variant ; 4219.0bp to feature; MODIFIER | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| vg0503041446 | G -> A | LOC_Os05g06070.1 | downstream_gene_variant ; 1766.0bp to feature; MODIFIER | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| vg0503041446 | G -> A | LOC_Os05g06070-LOC_Os05g06080 | intergenic_region ; MODIFIER | silent_mutation | Average:30.624; most accessible tissue: Callus, score: 77.988 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503041446 | NA | 4.25E-20 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 3.90E-47 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 3.62E-20 | mr1477 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 8.30E-13 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 8.75E-15 | mr1938 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 7.20E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 2.02E-21 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 3.15E-45 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503041446 | NA | 1.44E-21 | mr1971_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |