\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503041446:

Variant ID: vg0503041446 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3041446
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGTGAGCCATCCAAACTCACATATTTTAAATTCCCATGTTTCAGATTTACGTGGGACATTGGCTAGGGGAACGATGCTAATGCCATTAGTGCCGTTAT[G/A]
TTGTTGCATGATACCAATGACGTTGGCTCCACGAAAAGGGTTCATTACTAGAATAATATTTCTAGATGTCTATTTATGAAATAAGTTTTCAAAAAGGGTC

Reverse complement sequence

GACCCTTTTTGAAAACTTATTTCATAAATAGACATCTAGAAATATTATTCTAGTAATGAACCCTTTTCGTGGAGCCAACGTCATTGGTATCATGCAACAA[C/T]
ATAACGGCACTAATGGCATTAGCATCGTTCCCCTAGCCAATGTCCCACGTAAATCTGAAACATGGGAATTTAAAATATGTGAGTTTGGATGGCTCACAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.70% 38.50% 0.11% 0.74% NA
All Indica  2759 96.60% 2.20% 0.18% 0.94% NA
All Japonica  1512 2.20% 97.20% 0.00% 0.60% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 96.20% 1.00% 0.33% 2.52% NA
Indica Intermediate  786 95.80% 3.70% 0.13% 0.38% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 97.20% 0.00% 1.79% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503041446 G -> DEL N N silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N
vg0503041446 G -> A LOC_Os05g06080.1 upstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N
vg0503041446 G -> A LOC_Os05g06090.1 upstream_gene_variant ; 2940.0bp to feature; MODIFIER silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N
vg0503041446 G -> A LOC_Os05g06100.1 upstream_gene_variant ; 4476.0bp to feature; MODIFIER silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N
vg0503041446 G -> A LOC_Os05g06060.1 downstream_gene_variant ; 4219.0bp to feature; MODIFIER silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N
vg0503041446 G -> A LOC_Os05g06070.1 downstream_gene_variant ; 1766.0bp to feature; MODIFIER silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N
vg0503041446 G -> A LOC_Os05g06070-LOC_Os05g06080 intergenic_region ; MODIFIER silent_mutation Average:30.624; most accessible tissue: Callus, score: 77.988 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503041446 NA 4.25E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 3.90E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 3.62E-20 mr1477 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 8.30E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 8.75E-15 mr1938 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 7.20E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 2.02E-21 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 3.15E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446 NA 1.44E-21 mr1971_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251