Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503041446:

Variant ID: vg0503041446 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3041446
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGTGAGCCATCCAAACTCACATATTTTAAATTCCCATGTTTCAGATTTACGTGGGACATTGGCTAGGGGAACGATGCTAATGCCATTAGTGCCGTTAT[G/A]
TTGTTGCATGATACCAATGACGTTGGCTCCACGAAAAGGGTTCATTACTAGAATAATATTTCTAGATGTCTATTTATGAAATAAGTTTTCAAAAAGGGTC

Reverse complement sequence

GACCCTTTTTGAAAACTTATTTCATAAATAGACATCTAGAAATATTATTCTAGTAATGAACCCTTTTCGTGGAGCCAACGTCATTGGTATCATGCAACAA[C/T]
ATAACGGCACTAATGGCATTAGCATCGTTCCCCTAGCCAATGTCCCACGTAAATCTGAAACATGGGAATTTAAAATATGTGAGTTTGGATGGCTCACAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.70%	38.50%	0.11%	0.74%	NA
All Indica	2759	96.60%	2.20%	0.18%	0.94%	NA
All Japonica	1512	2.20%	97.20%	0.00%	0.60%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	96.20%	1.00%	0.33%	2.52%	NA
Indica Intermediate	786	95.80%	3.70%	0.13%	0.38%	NA
Temperate Japonica	767	2.50%	97.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	97.20%	0.00%	1.79%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503041446	G -> DEL	N	N	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N
vg0503041446	G -> A	LOC_Os05g06080.1	upstream_gene_variant ; 712.0bp to feature; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N
vg0503041446	G -> A	LOC_Os05g06090.1	upstream_gene_variant ; 2940.0bp to feature; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N
vg0503041446	G -> A	LOC_Os05g06100.1	upstream_gene_variant ; 4476.0bp to feature; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N
vg0503041446	G -> A	LOC_Os05g06060.1	downstream_gene_variant ; 4219.0bp to feature; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N
vg0503041446	G -> A	LOC_Os05g06070.1	downstream_gene_variant ; 1766.0bp to feature; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N
vg0503041446	G -> A	LOC_Os05g06070-LOC_Os05g06080	intergenic_region ; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Callus, score: 77.988	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503041446	NA	4.25E-20	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	3.90E-47	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	3.62E-20	mr1477	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	8.30E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	8.75E-15	mr1938	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	7.20E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	2.02E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	3.15E-45	mr1793_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503041446	NA	1.44E-21	mr1971_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251