Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503021903:

Variant ID: vg0503021903 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3021903
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTGAGGAATCAACTATGCAACTCGACACCGAAGTCAAGCTAGAAGCAGGACAGTCATGCCAGTAGTTAGAACTTATGGGAAAGTTAGTCAAGAGTCA[A/G]
TGTGTCCATGAGCTAAATGAGAGTCATCTTTATGTGGAATTTCCTATCATCAACTAAGGGTTAAGTTCCAAATCTTGTCAGGATGAAAGTGCATCGCCAT

Reverse complement sequence

ATGGCGATGCACTTTCATCCTGACAAGATTTGGAACTTAACCCTTAGTTGATGATAGGAAATTCCACATAAAGATGACTCTCATTTAGCTCATGGACACA[T/C]
TGACTCTTGACTAACTTTCCCATAAGTTCTAACTACTGGCATGACTGTCCTGCTTCTAGCTTGACTTCGGTGTCGAGTTGCATAGTTGATTCCTCAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.00%	14.20%	17.96%	3.85%	NA
All Indica	2759	46.70%	21.80%	28.60%	2.90%	NA
All Japonica	1512	88.80%	3.20%	1.59%	6.48%	NA
Aus	269	96.70%	1.50%	1.86%	0.00%	NA
Indica I	595	69.10%	1.70%	24.87%	4.37%	NA
Indica II	465	53.30%	12.90%	29.25%	4.52%	NA
Indica III	913	26.70%	43.20%	29.03%	1.10%	NA
Indica Intermediate	786	49.10%	17.40%	30.53%	2.93%	NA
Temperate Japonica	767	94.50%	0.00%	0.26%	5.22%	NA
Tropical Japonica	504	76.80%	9.30%	3.57%	10.32%	NA
Japonica Intermediate	241	95.40%	0.40%	1.66%	2.49%	NA
VI/Aromatic	96	74.00%	10.40%	15.62%	0.00%	NA
Intermediate	90	71.10%	6.70%	17.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503021903	A -> DEL	N	N	silent_mutation	Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N
vg0503021903	A -> G	LOC_Os05g06028.1	downstream_gene_variant ; 1605.0bp to feature; MODIFIER	silent_mutation	Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N
vg0503021903	A -> G	LOC_Os05g06040.1	downstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N
vg0503021903	A -> G	LOC_Os05g06014-LOC_Os05g06028	intergenic_region ; MODIFIER	silent_mutation	Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503021903	NA	3.05E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	2.27E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	9.38E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	6.53E-06	3.92E-10	mr1423	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	6.54E-09	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	3.92E-06	mr1656	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	2.36E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	9.43E-07	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903	NA	3.25E-07	mr1928	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251