\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503021903:

Variant ID: vg0503021903 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3021903
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.06, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGAGGAATCAACTATGCAACTCGACACCGAAGTCAAGCTAGAAGCAGGACAGTCATGCCAGTAGTTAGAACTTATGGGAAAGTTAGTCAAGAGTCA[A/G]
TGTGTCCATGAGCTAAATGAGAGTCATCTTTATGTGGAATTTCCTATCATCAACTAAGGGTTAAGTTCCAAATCTTGTCAGGATGAAAGTGCATCGCCAT

Reverse complement sequence

ATGGCGATGCACTTTCATCCTGACAAGATTTGGAACTTAACCCTTAGTTGATGATAGGAAATTCCACATAAAGATGACTCTCATTTAGCTCATGGACACA[T/C]
TGACTCTTGACTAACTTTCCCATAAGTTCTAACTACTGGCATGACTGTCCTGCTTCTAGCTTGACTTCGGTGTCGAGTTGCATAGTTGATTCCTCAAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 14.20% 17.96% 3.85% NA
All Indica  2759 46.70% 21.80% 28.60% 2.90% NA
All Japonica  1512 88.80% 3.20% 1.59% 6.48% NA
Aus  269 96.70% 1.50% 1.86% 0.00% NA
Indica I  595 69.10% 1.70% 24.87% 4.37% NA
Indica II  465 53.30% 12.90% 29.25% 4.52% NA
Indica III  913 26.70% 43.20% 29.03% 1.10% NA
Indica Intermediate  786 49.10% 17.40% 30.53% 2.93% NA
Temperate Japonica  767 94.50% 0.00% 0.26% 5.22% NA
Tropical Japonica  504 76.80% 9.30% 3.57% 10.32% NA
Japonica Intermediate  241 95.40% 0.40% 1.66% 2.49% NA
VI/Aromatic  96 74.00% 10.40% 15.62% 0.00% NA
Intermediate  90 71.10% 6.70% 17.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503021903 A -> DEL N N silent_mutation Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0503021903 A -> G LOC_Os05g06028.1 downstream_gene_variant ; 1605.0bp to feature; MODIFIER silent_mutation Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0503021903 A -> G LOC_Os05g06040.1 downstream_gene_variant ; 4796.0bp to feature; MODIFIER silent_mutation Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0503021903 A -> G LOC_Os05g06014-LOC_Os05g06028 intergenic_region ; MODIFIER silent_mutation Average:47.187; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503021903 NA 3.05E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 2.27E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 9.38E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 6.53E-06 3.92E-10 mr1423 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 6.54E-09 mr1599 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 3.92E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 2.36E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 9.43E-07 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503021903 NA 3.25E-07 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251