Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502983578:

Variant ID: vg0502983578 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2983578
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTCCGATACCGACAATTACCGATACCGATTGAAACGGTCGGTGCAAACCGGAAACGGTAGCCGGAATTCTCGGAAATTTCCGTACCGTTTTCACCCCT[A/C]
ATCTCAGCTCATCATCTCACTATACTCTCTTTAAGAAAAGTGATGATATAATTGGTATCCATTTCCATTTTCCCAATATAGAAAAGCTGCACCTCCATTC

Reverse complement sequence

GAATGGAGGTGCAGCTTTTCTATATTGGGAAAATGGAAATGGATACCAATTATATCATCACTTTTCTTAAAGAGAGTATAGTGAGATGATGAGCTGAGAT[T/G]
AGGGGTGAAAACGGTACGGAAATTTCCGAGAATTCCGGCTACCGTTTCCGGTTTGCACCGACCGTTTCAATCGGTATCGGTAATTGTCGGTATCGGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.30%	15.00%	31.44%	29.33%	NA
All Indica	2759	1.20%	20.00%	40.99%	37.84%	NA
All Japonica	1512	71.40%	2.90%	9.33%	16.40%	NA
Aus	269	0.40%	32.70%	46.47%	20.45%	NA
Indica I	595	0.70%	18.30%	45.55%	35.46%	NA
Indica II	465	2.20%	20.00%	37.85%	40.00%	NA
Indica III	913	1.00%	19.80%	37.90%	41.29%	NA
Indica Intermediate	786	1.30%	21.40%	43.00%	34.35%	NA
Temperate Japonica	767	94.70%	0.70%	2.09%	2.61%	NA
Tropical Japonica	504	33.10%	6.50%	19.44%	40.87%	NA
Japonica Intermediate	241	77.20%	2.50%	11.20%	9.13%	NA
VI/Aromatic	96	5.20%	13.50%	64.58%	16.67%	NA
Intermediate	90	32.20%	12.20%	30.00%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502983578	A -> DEL	N	N	silent_mutation	Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935	N	N	N	N
vg0502983578	A -> C	LOC_Os05g05970.1	upstream_gene_variant ; 1429.0bp to feature; MODIFIER	silent_mutation	Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935	N	N	N	N
vg0502983578	A -> C	LOC_Os05g05980.1	upstream_gene_variant ; 3546.0bp to feature; MODIFIER	silent_mutation	Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935	N	N	N	N
vg0502983578	A -> C	LOC_Os05g05960.1	downstream_gene_variant ; 261.0bp to feature; MODIFIER	silent_mutation	Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935	N	N	N	N
vg0502983578	A -> C	LOC_Os05g05960-LOC_Os05g05970	intergenic_region ; MODIFIER	silent_mutation	Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502983578	NA	4.15E-09	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	3.03E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	4.77E-10	mr1235	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	2.18E-07	mr1243	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	2.37E-16	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	1.56E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	9.06E-11	mr1423	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	2.32E-10	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	1.65E-07	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	2.66E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	8.03E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	3.66E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	1.54E-09	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	1.12E-10	mr1093_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	2.51E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	8.65E-08	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	3.50E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	7.19E-07	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	8.89E-08	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	8.37E-18	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	1.38E-06	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	3.40E-17	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578	NA	2.88E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251