\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502983578:

Variant ID: vg0502983578 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2983578
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCGATACCGACAATTACCGATACCGATTGAAACGGTCGGTGCAAACCGGAAACGGTAGCCGGAATTCTCGGAAATTTCCGTACCGTTTTCACCCCT[A/C]
ATCTCAGCTCATCATCTCACTATACTCTCTTTAAGAAAAGTGATGATATAATTGGTATCCATTTCCATTTTCCCAATATAGAAAAGCTGCACCTCCATTC

Reverse complement sequence

GAATGGAGGTGCAGCTTTTCTATATTGGGAAAATGGAAATGGATACCAATTATATCATCACTTTTCTTAAAGAGAGTATAGTGAGATGATGAGCTGAGAT[T/G]
AGGGGTGAAAACGGTACGGAAATTTCCGAGAATTCCGGCTACCGTTTCCGGTTTGCACCGACCGTTTCAATCGGTATCGGTAATTGTCGGTATCGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.30% 15.00% 31.44% 29.33% NA
All Indica  2759 1.20% 20.00% 40.99% 37.84% NA
All Japonica  1512 71.40% 2.90% 9.33% 16.40% NA
Aus  269 0.40% 32.70% 46.47% 20.45% NA
Indica I  595 0.70% 18.30% 45.55% 35.46% NA
Indica II  465 2.20% 20.00% 37.85% 40.00% NA
Indica III  913 1.00% 19.80% 37.90% 41.29% NA
Indica Intermediate  786 1.30% 21.40% 43.00% 34.35% NA
Temperate Japonica  767 94.70% 0.70% 2.09% 2.61% NA
Tropical Japonica  504 33.10% 6.50% 19.44% 40.87% NA
Japonica Intermediate  241 77.20% 2.50% 11.20% 9.13% NA
VI/Aromatic  96 5.20% 13.50% 64.58% 16.67% NA
Intermediate  90 32.20% 12.20% 30.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502983578 A -> DEL N N silent_mutation Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935 N N N N
vg0502983578 A -> C LOC_Os05g05970.1 upstream_gene_variant ; 1429.0bp to feature; MODIFIER silent_mutation Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935 N N N N
vg0502983578 A -> C LOC_Os05g05980.1 upstream_gene_variant ; 3546.0bp to feature; MODIFIER silent_mutation Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935 N N N N
vg0502983578 A -> C LOC_Os05g05960.1 downstream_gene_variant ; 261.0bp to feature; MODIFIER silent_mutation Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935 N N N N
vg0502983578 A -> C LOC_Os05g05960-LOC_Os05g05970 intergenic_region ; MODIFIER silent_mutation Average:38.14; most accessible tissue: Zhenshan97 flower, score: 54.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502983578 NA 4.15E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 3.03E-11 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 4.77E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 2.18E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 2.37E-16 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 1.56E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 9.06E-11 mr1423 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 2.32E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 1.65E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 2.66E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 8.03E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 3.66E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 1.54E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 1.12E-10 mr1093_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 2.51E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 8.65E-08 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 3.50E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 7.19E-07 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 8.89E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 8.37E-18 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 1.38E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 3.40E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502983578 NA 2.88E-16 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251