| Variant ID: vg0502606736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2606736 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTAAATTCTAAATTGGTTATATTCTCTTCTTAAGCTTATGATTGGTTGAAAATGCTTGAGTTTCCATGCATTGAAAAATCATGTATCCTTCTAAAATGA[C/T]
ATTGTAGTCTAATGTTAAAAATACTTATGTTTTAGGGGTAGAATGGAGCGAGTACAAATATTCCTAAGAATCCAGTTGCTACACGGAACAAGAAGATGTT
AACATCTTCTTGTTCCGTGTAGCAACTGGATTCTTAGGAATATTTGTACTCGCTCCATTCTACCCCTAAAACATAAGTATTTTTAACATTAGACTACAAT[G/A]
TCATTTTAGAAGGATACATGATTTTTCAATGCATGGAAACTCAAGCATTTTCAACCAATCATAAGCTTAAGAAGAGAATATAACCAATTTAGAATTTAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 21.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 37.00% | 63.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 22.80% | 77.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502606736 | C -> T | LOC_Os05g05280.1 | upstream_gene_variant ; 2569.0bp to feature; MODIFIER | silent_mutation | Average:56.744; most accessible tissue: Callus, score: 88.241 | N | N | N | N |
| vg0502606736 | C -> T | LOC_Os05g05290.1 | upstream_gene_variant ; 472.0bp to feature; MODIFIER | silent_mutation | Average:56.744; most accessible tissue: Callus, score: 88.241 | N | N | N | N |
| vg0502606736 | C -> T | LOC_Os05g05300.1 | upstream_gene_variant ; 2668.0bp to feature; MODIFIER | silent_mutation | Average:56.744; most accessible tissue: Callus, score: 88.241 | N | N | N | N |
| vg0502606736 | C -> T | LOC_Os05g05310.1 | downstream_gene_variant ; 4947.0bp to feature; MODIFIER | silent_mutation | Average:56.744; most accessible tissue: Callus, score: 88.241 | N | N | N | N |
| vg0502606736 | C -> T | LOC_Os05g05310.2 | downstream_gene_variant ; 4947.0bp to feature; MODIFIER | silent_mutation | Average:56.744; most accessible tissue: Callus, score: 88.241 | N | N | N | N |
| vg0502606736 | C -> T | LOC_Os05g05290-LOC_Os05g05300 | intergenic_region ; MODIFIER | silent_mutation | Average:56.744; most accessible tissue: Callus, score: 88.241 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502606736 | NA | 2.12E-35 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0502606736 | NA | 3.28E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 2.70E-07 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 1.14E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 2.36E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 1.67E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 7.54E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 4.15E-17 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 3.83E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502606736 | NA | 1.36E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/