| Variant ID: vg0502574829 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2574829 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, T: 0.01, others allele: 0.00, population size: 195. )
AATCCACTGAACAGCTTTCCAGTGTTCTTTAACAGGATTAGCCATGTATCTACTAACTAAACTCATAGCATGAGATAAATCCGGATGGGAGCAAACCATG[A/G]
CATACATCAAATAACCAACAACACTAGAATATGGAACTCTTGACATGTATTCTACATACTCATCAGTACTAGCACATTGTAAAGCTGATAATTTAAAATA
TATTTTAAATTATCAGCTTTACAATGTGCTAGTACTGATGAGTATGTAGAATACATGTCAAGAGTTCCATATTCTAGTGTTGTTGGTTATTTGATGTATG[T/C]
CATGGTTTGCTCCCATCCGGATTTATCTCATGCTATGAGTTTAGTTAGTAGATACATGGCTAATCCTGTTAAAGAACACTGGAAAGCTGTTCAGTGGATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 33.90% | 66.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 5.50% | 94.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.10% | 16.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.60% | 78.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502574829 | A -> G | LOC_Os05g05250.1 | upstream_gene_variant ; 56.0bp to feature; MODIFIER | silent_mutation | Average:43.755; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0502574829 | A -> G | LOC_Os05g05240.1 | downstream_gene_variant ; 1671.0bp to feature; MODIFIER | silent_mutation | Average:43.755; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0502574829 | A -> G | LOC_Os05g05240.2 | downstream_gene_variant ; 1671.0bp to feature; MODIFIER | silent_mutation | Average:43.755; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0502574829 | A -> G | LOC_Os05g05250-LOC_Os05g05260 | intergenic_region ; MODIFIER | silent_mutation | Average:43.755; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502574829 | NA | 3.63E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 6.44E-16 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 3.04E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 2.83E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 1.60E-15 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 3.15E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 4.76E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 3.74E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 1.25E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502574829 | NA | 1.76E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/