Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502503516:

Variant ID: vg0502503516 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2503516
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGATATTTTCGGTTGCCAACTTGGCTGCTTGCTTGGCACTGCCACCTCGACCATCTCCCTCAACTTCCCAACCCATCTAGCTCGTTTTCCACGTGCACG[T/C]
TTTTCAAACTGCTAAACGTTATGTTTTTTATAAAAAGTTTCTATACAAAAGTTACTTAAAAAATCAAATTAATCCATTTTTGAAAAAAAAATAGCTAATA

Reverse complement sequence

TATTAGCTATTTTTTTTTCAAAAATGGATTAATTTGATTTTTTAAGTAACTTTTGTATAGAAACTTTTTATAAAAAACATAACGTTTAGCAGTTTGAAAA[A/G]
CGTGCACGTGGAAAACGAGCTAGATGGGTTGGGAAGTTGAGGGAGATGGTCGAGGTGGCAGTGCCAAGCAAGCAGCCAAGTTGGCAACCGAAAATATCAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	20.50%	0.13%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.04%	0.00%	NA
All Japonica	1512	38.70%	61.00%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	6.30%	93.20%	0.52%	0.00%	NA
Tropical Japonica	504	92.70%	7.30%	0.00%	0.00%	NA
Japonica Intermediate	241	29.00%	70.50%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502503516	T -> C	LOC_Os05g05140.1	upstream_gene_variant ; 128.0bp to feature; MODIFIER	silent_mutation	Average:96.259; most accessible tissue: Zhenshan97 flag leaf, score: 99.231	N	N	N	N
vg0502503516	T -> C	LOC_Os05g05150.1	upstream_gene_variant ; 2706.0bp to feature; MODIFIER	silent_mutation	Average:96.259; most accessible tissue: Zhenshan97 flag leaf, score: 99.231	N	N	N	N
vg0502503516	T -> C	LOC_Os05g05140.2	upstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:96.259; most accessible tissue: Zhenshan97 flag leaf, score: 99.231	N	N	N	N
vg0502503516	T -> C	LOC_Os05g05130.1	downstream_gene_variant ; 4074.0bp to feature; MODIFIER	silent_mutation	Average:96.259; most accessible tissue: Zhenshan97 flag leaf, score: 99.231	N	N	N	N
vg0502503516	T -> C	LOC_Os05g05140-LOC_Os05g05150	intergenic_region ; MODIFIER	silent_mutation	Average:96.259; most accessible tissue: Zhenshan97 flag leaf, score: 99.231	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0502503516	T	C	0.02	0.01	0.0	0.0	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502503516	NA	1.14E-36	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0502503516	NA	5.48E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	7.14E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	8.59E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	2.98E-18	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.87E-09	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	5.53E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.31E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.19E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	6.18E-19	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	8.24E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	7.50E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	2.74E-07	9.00E-32	mr1593_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	7.08E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.57E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.01E-06	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.36E-16	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	2.60E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	1.29E-08	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	5.63E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502503516	NA	4.32E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251