Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502391941:

Variant ID: vg0502391941 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2391941
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACACGAAAACATGATAGCTCATTAACACATGGTTAATTAAGTGTACTAGCTAAAAGAACTTGAAAAATGGATTAATATGATTTTTAAAAACAACTTT[C/T]
ATATAGAATTTTTTTTTAAACGCATACCGTTTAGCAGTTCAGAAAGTGTATGCATAGAAAAATGATATAGTAGAAGTTGGGAAAGAGTAGTGCCGAACTA

Reverse complement sequence

TAGTTCGGCACTACTCTTTCCCAACTTCTACTATATCATTTTTCTATGCATACACTTTCTGAACTGCTAAACGGTATGCGTTTAAAAAAAAATTCTATAT[G/A]
AAAGTTGTTTTTAAAAATCATATTAATCCATTTTTCAAGTTCTTTTAGCTAGTACACTTAATTAACCATGTGTTAATGAGCTATCATGTTTTCGTGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	36.50%	0.15%	0.00%	NA
All Indica	2759	68.20%	31.80%	0.04%	0.00%	NA
All Japonica	1512	58.00%	41.70%	0.33%	0.00%	NA
Aus	269	59.90%	40.10%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	88.40%	11.60%	0.00%	0.00%	NA
Indica III	913	34.20%	65.80%	0.00%	0.00%	NA
Indica Intermediate	786	73.00%	26.80%	0.13%	0.00%	NA
Temperate Japonica	767	94.30%	5.50%	0.26%	0.00%	NA
Tropical Japonica	504	3.20%	96.80%	0.00%	0.00%	NA
Japonica Intermediate	241	57.30%	41.50%	1.24%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502391941	C -> T	LOC_Os05g04950.1	upstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N
vg0502391941	C -> T	LOC_Os05g04950.2	upstream_gene_variant ; 4753.0bp to feature; MODIFIER	silent_mutation	Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N
vg0502391941	C -> T	LOC_Os05g04950-LOC_Os05g04960	intergenic_region ; MODIFIER	silent_mutation	Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502391941	NA	7.00E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	NA	7.95E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	NA	4.07E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	NA	3.15E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	NA	8.88E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	NA	4.56E-09	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	NA	3.12E-08	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941	7.13E-07	NA	mr1973_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251