\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502391941:

Variant ID: vg0502391941 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2391941
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACACGAAAACATGATAGCTCATTAACACATGGTTAATTAAGTGTACTAGCTAAAAGAACTTGAAAAATGGATTAATATGATTTTTAAAAACAACTTT[C/T]
ATATAGAATTTTTTTTTAAACGCATACCGTTTAGCAGTTCAGAAAGTGTATGCATAGAAAAATGATATAGTAGAAGTTGGGAAAGAGTAGTGCCGAACTA

Reverse complement sequence

TAGTTCGGCACTACTCTTTCCCAACTTCTACTATATCATTTTTCTATGCATACACTTTCTGAACTGCTAAACGGTATGCGTTTAAAAAAAAATTCTATAT[G/A]
AAAGTTGTTTTTAAAAATCATATTAATCCATTTTTCAAGTTCTTTTAGCTAGTACACTTAATTAACCATGTGTTAATGAGCTATCATGTTTTCGTGTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.50% 0.15% 0.00% NA
All Indica  2759 68.20% 31.80% 0.04% 0.00% NA
All Japonica  1512 58.00% 41.70% 0.33% 0.00% NA
Aus  269 59.90% 40.10% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 34.20% 65.80% 0.00% 0.00% NA
Indica Intermediate  786 73.00% 26.80% 0.13% 0.00% NA
Temperate Japonica  767 94.30% 5.50% 0.26% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 57.30% 41.50% 1.24% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502391941 C -> T LOC_Os05g04950.1 upstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484 N N N N
vg0502391941 C -> T LOC_Os05g04950.2 upstream_gene_variant ; 4753.0bp to feature; MODIFIER silent_mutation Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484 N N N N
vg0502391941 C -> T LOC_Os05g04950-LOC_Os05g04960 intergenic_region ; MODIFIER silent_mutation Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502391941 NA 7.00E-06 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 NA 7.95E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 NA 4.07E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 NA 3.15E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 NA 8.88E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 NA 4.56E-09 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 NA 3.12E-08 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502391941 7.13E-07 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251