\
| Variant ID: vg0502391941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2391941 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.51, C: 0.49, others allele: 0.00, population size: 88. )
ACCACACGAAAACATGATAGCTCATTAACACATGGTTAATTAAGTGTACTAGCTAAAAGAACTTGAAAAATGGATTAATATGATTTTTAAAAACAACTTT[C/T]
ATATAGAATTTTTTTTTAAACGCATACCGTTTAGCAGTTCAGAAAGTGTATGCATAGAAAAATGATATAGTAGAAGTTGGGAAAGAGTAGTGCCGAACTA
TAGTTCGGCACTACTCTTTCCCAACTTCTACTATATCATTTTTCTATGCATACACTTTCTGAACTGCTAAACGGTATGCGTTTAAAAAAAAATTCTATAT[G/A]
AAAGTTGTTTTTAAAAATCATATTAATCCATTTTTCAAGTTCTTTTAGCTAGTACACTTAATTAACCATGTGTTAATGAGCTATCATGTTTTCGTGTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 36.50% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 68.20% | 31.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 58.00% | 41.70% | 0.33% | 0.00% | NA |
| Aus | 269 | 59.90% | 40.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 34.20% | 65.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 73.00% | 26.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.50% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 3.20% | 96.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 41.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502391941 | C -> T | LOC_Os05g04950.1 | upstream_gene_variant ; 4827.0bp to feature; MODIFIER | silent_mutation | Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484 | N | N | N | N |
| vg0502391941 | C -> T | LOC_Os05g04950.2 | upstream_gene_variant ; 4753.0bp to feature; MODIFIER | silent_mutation | Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484 | N | N | N | N |
| vg0502391941 | C -> T | LOC_Os05g04950-LOC_Os05g04960 | intergenic_region ; MODIFIER | silent_mutation | Average:51.007; most accessible tissue: Minghui63 flower, score: 74.484 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502391941 | NA | 7.00E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | NA | 7.95E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | NA | 4.07E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | NA | 3.15E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | NA | 8.88E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | NA | 4.56E-09 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | NA | 3.12E-08 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502391941 | 7.13E-07 | NA | mr1973_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |