\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502333732:

Variant ID: vg0502333732 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2333732
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGCAATGTGATAATGTGAAATCCTAAATATTGATTTCTTTTTGTTTCATTTTTTTTCTAATTACACATGTAAAGATTTACACTGTTTCTATTTCCCT[G/A]
CTATCAAATACTTCTGTTGAAGTCGGAACCACTGACAAGATACATTCACAGTGCAACATGTTGTAAGCATTGGATATCCTCACATGTATGAAATTATAAT

Reverse complement sequence

ATTATAATTTCATACATGTGAGGATATCCAATGCTTACAACATGTTGCACTGTGAATGTATCTTGTCAGTGGTTCCGACTTCAACAGAAGTATTTGATAG[C/T]
AGGGAAATAGAAACAGTGTAAATCTTTACATGTGTAATTAGAAAAAAAATGAAACAAAAAGAAATCAATATTTAGGATTTCACATTATCACATTGCCACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 18.30% 0.04% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 45.00% 54.80% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 11.70% 88.10% 0.13% 0.00% NA
Tropical Japonica  504 89.10% 10.70% 0.20% 0.00% NA
Japonica Intermediate  241 58.90% 41.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502333732 G -> A LOC_Os05g04840.1 downstream_gene_variant ; 3649.0bp to feature; MODIFIER silent_mutation Average:67.771; most accessible tissue: Callus, score: 90.674 N N N N
vg0502333732 G -> A LOC_Os05g04860.1 downstream_gene_variant ; 980.0bp to feature; MODIFIER silent_mutation Average:67.771; most accessible tissue: Callus, score: 90.674 N N N N
vg0502333732 G -> A LOC_Os05g04850.2 downstream_gene_variant ; 678.0bp to feature; MODIFIER silent_mutation Average:67.771; most accessible tissue: Callus, score: 90.674 N N N N
vg0502333732 G -> A LOC_Os05g04860.2 downstream_gene_variant ; 979.0bp to feature; MODIFIER silent_mutation Average:67.771; most accessible tissue: Callus, score: 90.674 N N N N
vg0502333732 G -> A LOC_Os05g04850.1 intron_variant ; MODIFIER silent_mutation Average:67.771; most accessible tissue: Callus, score: 90.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502333732 NA 3.94E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 3.64E-19 mr1308 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 4.96E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 2.01E-18 mr1401 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 1.21E-08 mr1401 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 4.90E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 4.50E-22 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 1.52E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 5.31E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 6.85E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 3.66E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 2.97E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 2.80E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 1.46E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502333732 NA 6.64E-12 mr1853_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251