\
| Variant ID: vg0502285091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2285091 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCGCATGTGAAAATAAGCTCATTTTCGCGTGCGGTCCTCTTAAATGAACCGCACGTGAAAATGAGCCTATTTTTATAGACGCGACCAGTTATGATCCGT[T/C]
TGCAATCTAAATGAGTCCGTGTCCAGAAAAATCGTCTGTGTAATAGTGAACGAGAGATATTGTTGGATCTTCATGACAGAGGTGGCGGCCCTACTAGTTC
GAACTAGTAGGGCCGCCACCTCTGTCATGAAGATCCAACAATATCTCTCGTTCACTATTACACAGACGATTTTTCTGGACACGGACTCATTTAGATTGCA[A/G]
ACGGATCATAACTGGTCGCGTCTATAAAAATAGGCTCATTTTCACGTGCGGTTCATTTAAGAGGACCGCACGCGAAAATGAGCTTATTTTCACATGCGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 23.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 31.30% | 68.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 7.20% | 92.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.50% | 34.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.90% | 62.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502285091 | T -> C | LOC_Os05g04790-LOC_Os05g04810 | intergenic_region ; MODIFIER | silent_mutation | Average:62.818; most accessible tissue: Zhenshan97 panicle, score: 75.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502285091 | NA | 3.03E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | 6.94E-06 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 2.36E-30 | mr1423_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 8.90E-07 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 3.62E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 1.72E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 6.20E-07 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 4.98E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | 8.29E-07 | NA | mr1705_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | 3.37E-06 | NA | mr1705_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 6.28E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 7.53E-31 | mr1789_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 3.09E-12 | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 6.13E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 2.54E-13 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502285091 | NA | 9.75E-07 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |