\
| Variant ID: vg0502284343 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2284343 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 96. )
CCGCACGCATCCAAGGGTATGCGAAAATCATGATTTTTGCGTGCGGGTGCTTACCTGCAAGGGAAAATAAAAATCCGAAAAAAAATAAAATTTCAAAAAA[C/T]
GAATCCGGCGTCCCGGCCGCCGCCGCTCCCGGCCGCCGCCGCCTCCTCCTCCTCCTCCTCCTCCTCCTCGTCGTCCTCATCATCGTCGTCGTCAGCCAAC
GTTGGCTGACGACGACGATGATGAGGACGACGAGGAGGAGGAGGAGGAGGAGGAGGAGGCGGCGGCGGCCGGGAGCGGCGGCGGCCGGGACGCCGGATTC[G/A]
TTTTTTGAAATTTTATTTTTTTTCGGATTTTTATTTTCCCTTGCAGGTAAGCACCCGCACGCAAAAATCATGATTTTCGCATACCCTTGGATGCGTGCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.30% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 69.20% | 30.40% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 28.20% | 71.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 36.40% | 1.86% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 79.10% | 20.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 44.40% | 55.00% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 69.00% | 30.40% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 6.60% | 93.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 28.20% | 71.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 82.30% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 44.40% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502284343 | C -> T | LOC_Os05g04790.1 | downstream_gene_variant ; 4295.0bp to feature; MODIFIER | silent_mutation | Average:73.535; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| vg0502284343 | C -> T | LOC_Os05g04790-LOC_Os05g04810 | intergenic_region ; MODIFIER | silent_mutation | Average:73.535; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502284343 | NA | 6.11E-06 | mr1120 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | 6.78E-06 | NA | mr1301 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 4.57E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 5.63E-06 | mr1109_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | 9.60E-06 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 7.49E-08 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 9.92E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 2.54E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 1.38E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 6.91E-12 | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 1.44E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 6.45E-12 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 8.35E-06 | mr1844_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502284343 | NA | 4.19E-06 | mr1957_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |