Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502242174:

Variant ID: vg0502242174 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2242174
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTAGCTGCTCCTACATATATATACTGTATCCACTCAGCTATGTCGCTATGTCCTGCGGAAAACTCTTTTAATCACTCGAGTAGATGTCCACTCGTTTA[T/A]
TACATATATCTAAATAGTTATAAAAAAATTAAAACTTTTTTAACAAGATAGATCAATATGTAATATATAACTACACAAACATGCATGCAAGCTAAAATTC

Reverse complement sequence

GAATTTTAGCTTGCATGCATGTTTGTGTAGTTATATATTACATATTGATCTATCTTGTTAAAAAAGTTTTAATTTTTTTATAACTATTTAGATATATGTA[A/T]
TAAACGAGTGGACATCTACTCGAGTGATTAAAAGAGTTTTCCGCAGGACATAGCGACATAGCTGAGTGGATACAGTATATATATGTAGGAGCAGCTAACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	27.50%	0.25%	0.00%	NA
All Indica	2759	98.40%	1.40%	0.14%	0.00%	NA
All Japonica	1512	18.70%	81.00%	0.33%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	96.60%	2.80%	0.65%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.40%	0.13%	0.00%	NA
Temperate Japonica	767	4.40%	95.30%	0.26%	0.00%	NA
Tropical Japonica	504	37.10%	62.70%	0.20%	0.00%	NA
Japonica Intermediate	241	25.70%	73.40%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	55.60%	41.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502242174	T -> A	LOC_Os05g04740.2	upstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:63.083; most accessible tissue: Callus, score: 92.773	N	N	N	N
vg0502242174	T -> A	LOC_Os05g04740.1	upstream_gene_variant ; 4661.0bp to feature; MODIFIER	silent_mutation	Average:63.083; most accessible tissue: Callus, score: 92.773	N	N	N	N
vg0502242174	T -> A	LOC_Os05g04730.1	downstream_gene_variant ; 4217.0bp to feature; MODIFIER	silent_mutation	Average:63.083; most accessible tissue: Callus, score: 92.773	N	N	N	N
vg0502242174	T -> A	LOC_Os05g04730-LOC_Os05g04740	intergenic_region ; MODIFIER	silent_mutation	Average:63.083; most accessible tissue: Callus, score: 92.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502242174	NA	1.97E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.00E-10	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	3.91E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.09E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	3.40E-06	2.80E-16	mr1401	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	8.14E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	7.33E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.52E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.56E-14	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	4.16E-21	mr1584	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	3.61E-07	mr1584	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	8.49E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.60E-07	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	7.71E-09	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	2.02E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.33E-13	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	2.41E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	1.88E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	5.29E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174	NA	5.57E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251