\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502242174:

Variant ID: vg0502242174 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2242174
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTAGCTGCTCCTACATATATATACTGTATCCACTCAGCTATGTCGCTATGTCCTGCGGAAAACTCTTTTAATCACTCGAGTAGATGTCCACTCGTTTA[T/A]
TACATATATCTAAATAGTTATAAAAAAATTAAAACTTTTTTAACAAGATAGATCAATATGTAATATATAACTACACAAACATGCATGCAAGCTAAAATTC

Reverse complement sequence

GAATTTTAGCTTGCATGCATGTTTGTGTAGTTATATATTACATATTGATCTATCTTGTTAAAAAAGTTTTAATTTTTTTATAACTATTTAGATATATGTA[A/T]
TAAACGAGTGGACATCTACTCGAGTGATTAAAAGAGTTTTCCGCAGGACATAGCGACATAGCTGAGTGGATACAGTATATATATGTAGGAGCAGCTAACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 27.50% 0.25% 0.00% NA
All Indica  2759 98.40% 1.40% 0.14% 0.00% NA
All Japonica  1512 18.70% 81.00% 0.33% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 96.60% 2.80% 0.65% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 4.40% 95.30% 0.26% 0.00% NA
Tropical Japonica  504 37.10% 62.70% 0.20% 0.00% NA
Japonica Intermediate  241 25.70% 73.40% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502242174 T -> A LOC_Os05g04740.2 upstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:63.083; most accessible tissue: Callus, score: 92.773 N N N N
vg0502242174 T -> A LOC_Os05g04740.1 upstream_gene_variant ; 4661.0bp to feature; MODIFIER silent_mutation Average:63.083; most accessible tissue: Callus, score: 92.773 N N N N
vg0502242174 T -> A LOC_Os05g04730.1 downstream_gene_variant ; 4217.0bp to feature; MODIFIER silent_mutation Average:63.083; most accessible tissue: Callus, score: 92.773 N N N N
vg0502242174 T -> A LOC_Os05g04730-LOC_Os05g04740 intergenic_region ; MODIFIER silent_mutation Average:63.083; most accessible tissue: Callus, score: 92.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502242174 NA 1.97E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.00E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 3.91E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.09E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 3.40E-06 2.80E-16 mr1401 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 8.14E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 7.33E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.52E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.56E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 4.16E-21 mr1584 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 3.61E-07 mr1584 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 8.49E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.60E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 7.71E-09 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 2.02E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.33E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 2.41E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 1.88E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 5.29E-10 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502242174 NA 5.57E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251