\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502177239:

Variant ID: vg0502177239 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2177239
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCTAGGAAGGATTAGATTGATTTTGAATTAAGGAGGGGGTGAGGCTCGAACCCTGACCGGCTAGCTCGCAGCTTGCGTTGCTAGCCGGGAAGACCCC[G/A]
GACCTTTATCATTGAGTATGGCTGTAATATTGAGCAATATGGTGTGACTTCTAAAATCTTTGCACCTTCTGTTATTTCCAGGCTATAGTTGCTCAGGTGA

Reverse complement sequence

TCACCTGAGCAACTATAGCCTGGAAATAACAGAAGGTGCAAAGATTTTAGAAGTCACACCATATTGCTCAATATTACAGCCATACTCAATGATAAAGGTC[C/T]
GGGGTCTTCCCGGCTAGCAACGCAAGCTGCGAGCTAGCCGGTCAGGGTTCGAGCCTCACCCCCTCCTTAATTCAAAATCAATCTAATCCTTCCTAGATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.30% 0.80% 0.93% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.70% 2.40% 2.91% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 90.70% 4.60% 4.69% 0.00% NA
Tropical Japonica  504 99.00% 0.00% 0.99% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502177239 G -> A LOC_Os05g04620.1 downstream_gene_variant ; 3027.0bp to feature; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04640.1 downstream_gene_variant ; 2281.0bp to feature; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04630.1 intron_variant ; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04630.2 intron_variant ; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04630.6 intron_variant ; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04630.3 intron_variant ; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04630.4 intron_variant ; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N
vg0502177239 G -> A LOC_Os05g04630.5 intron_variant ; MODIFIER silent_mutation Average:64.869; most accessible tissue: Minghui63 young leaf, score: 83.166 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502177239 G A 0.01 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502177239 NA 3.87E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 2.64E-06 2.63E-06 mr1369 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 NA 9.65E-08 mr1453 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 NA 2.89E-08 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 NA 4.11E-08 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 NA 2.57E-08 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 NA 4.32E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502177239 NA 4.91E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251