\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502171217:

Variant ID: vg0502171217 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2171217
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGAGAAGGGGAAGCATGATGCATTGATCGGCATCAAGGATGGAGCTTACGCCTCCCTCGTCGCCCTCCATGTTTCTGCTGCTGCCATTTCGTAGCAGA[T/G]
CTAGCAGACGCCATGGATGAAAAGATCATGGTTTGTTGCTGAATCTGTGAGAGGAGCAAGAGACTGGTGTAACTGTAGCTTGTGCAGGCTCCAGCTCTTG

Reverse complement sequence

CAAGAGCTGGAGCCTGCACAAGCTACAGTTACACCAGTCTCTTGCTCCTCTCACAGATTCAGCAACAAACCATGATCTTTTCATCCATGGCGTCTGCTAG[A/C]
TCTGCTACGAAATGGCAGCAGCAGAAACATGGAGGGCGACGAGGGAGGCGTAAGCTCCATCCTTGATGCCGATCAATGCATCATGCTTCCCCTTCTCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.70% 0.19% 0.00% NA
All Indica  2759 80.40% 19.30% 0.25% 0.00% NA
All Japonica  1512 17.60% 82.30% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 87.70% 12.30% 0.00% 0.00% NA
Indica III  913 58.90% 40.60% 0.44% 0.00% NA
Indica Intermediate  786 86.50% 13.20% 0.25% 0.00% NA
Temperate Japonica  767 7.00% 92.70% 0.26% 0.00% NA
Tropical Japonica  504 28.20% 71.80% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 71.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502171217 T -> G LOC_Os05g04610.1 3_prime_UTR_variant ; 5.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04620.1 upstream_gene_variant ; 988.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04630.1 upstream_gene_variant ; 3655.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04630.2 upstream_gene_variant ; 3663.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04630.6 upstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04630.3 upstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04630.4 upstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04630.5 upstream_gene_variant ; 3705.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N
vg0502171217 T -> G LOC_Os05g04600.1 downstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:70.403; most accessible tissue: Zhenshan97 flag leaf, score: 94.34 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502171217 T G -0.02 -0.02 -0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502171217 NA 1.26E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 2.40E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 5.24E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 5.55E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 4.99E-06 NA mr1093_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 6.28E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 3.90E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 2.23E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502171217 NA 1.78E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251