\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502169913:

Variant ID: vg0502169913 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2169913
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


CCGGTGCTCGGCTTGTCGAGGACAGGAAAACAACATTTCCTAACGTTTTCAGGGTATGTGCAGTGTTCACTACAAGATATTTACAGACTCAAACTTTTAA[A/G]
CTTTTTAGGCACTTGCATGTCAATATGCTAGTTGAAGATTTGCACGTCAATATGCTAGTTGAATATAGATTTTTCAAAGGGGCATTGAGATTTAAACTTC

Reverse complement sequence

GAAGTTTAAATCTCAATGCCCCTTTGAAAAATCTATATTCAACTAGCATATTGACGTGCAAATCTTCAACTAGCATATTGACATGCAAGTGCCTAAAAAG[T/C]
TTAAAAGTTTGAGTCTGTAAATATCTTGTAGTGAACACTGCACATACCCTGAAAACGTTAGGAAATGTTGTTTTCCTGTCCTCGACAAGCCGAGCACCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.20% 0.11% 0.00% NA
All Indica  2759 85.90% 13.90% 0.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 75.00% 24.50% 0.50% 0.00% NA
Indica II  465 91.40% 8.20% 0.43% 0.00% NA
Indica III  913 83.90% 16.10% 0.00% 0.00% NA
Indica Intermediate  786 93.40% 6.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502169913 A -> G LOC_Os05g04620.1 upstream_gene_variant ; 2292.0bp to feature; MODIFIER silent_mutation Average:46.407; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0502169913 A -> G LOC_Os05g04630.1 upstream_gene_variant ; 4959.0bp to feature; MODIFIER silent_mutation Average:46.407; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0502169913 A -> G LOC_Os05g04630.2 upstream_gene_variant ; 4967.0bp to feature; MODIFIER silent_mutation Average:46.407; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0502169913 A -> G LOC_Os05g04630.6 upstream_gene_variant ; 4987.0bp to feature; MODIFIER silent_mutation Average:46.407; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0502169913 A -> G LOC_Os05g04600.1 downstream_gene_variant ; 3020.0bp to feature; MODIFIER silent_mutation Average:46.407; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0502169913 A -> G LOC_Os05g04610.1 intron_variant ; MODIFIER silent_mutation Average:46.407; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502169913 NA 8.61E-06 mr1036 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 4.12E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 6.61E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.81E-08 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.24E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.46E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.10E-06 mr1156 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 4.67E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 7.03E-06 4.56E-09 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 3.48E-08 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 2.16E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.83E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 4.50E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 2.02E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 3.39E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.45E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.20E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.72E-07 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 3.65E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.05E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 1.33E-06 1.14E-07 mr1545 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 2.79E-08 2.79E-08 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 3.52E-06 3.51E-06 mr1591 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 5.45E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 3.19E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 5.85E-06 mr1737 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 2.17E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 1.26E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 8.05E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 5.51E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 4.84E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 2.49E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502169913 NA 7.11E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251