Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502167695:

Variant ID: vg0502167695 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2167695
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.11, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TCAACAGGGAGCCAGAGATCGATGCGTACAGCGCCACAGGTAGGAAGCTAGATGACATTCAGGGGGATATCGAGTTCAGAAACGTTTACTTTTCGTACCC[G/A]
ACAAGGCCCGATGAGCAAATATTCAGAGGGTTCTCGCTTGCCATACAGAGTGGAACAACTGTTGCATTGGTTGGACAGAGTGGGAGTGGAAAATCAACAG

Reverse complement sequence

CTGTTGATTTTCCACTCCCACTCTGTCCAACCAATGCAACAGTTGTTCCACTCTGTATGGCAAGCGAGAACCCTCTGAATATTTGCTCATCGGGCCTTGT[C/T]
GGGTACGAAAAGTAAACGTTTCTGAACTCGATATCCCCCTGAATGTCATCTAGCTTCCTACCTGTGGCGCTGTACGCATCGATCTCTGGCTCCCTGTTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 40.40% 0.15% 0.00% NA
All Indica  2759 48.10% 51.70% 0.22% 0.00% NA
All Japonica  1512 85.10% 14.80% 0.07% 0.00% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 26.60% 73.10% 0.34% 0.00% NA
Indica II  465 29.20% 70.80% 0.00% 0.00% NA
Indica III  913 76.10% 23.50% 0.33% 0.00% NA
Indica Intermediate  786 43.00% 56.90% 0.13% 0.00% NA
Temperate Japonica  767 94.40% 5.50% 0.13% 0.00% NA
Tropical Japonica  504 73.80% 26.20% 0.00% 0.00% NA
Japonica Intermediate  241 79.30% 20.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502167695 G -> A LOC_Os05g04610.1 upstream_gene_variant ; 1285.0bp to feature; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0502167695 G -> A LOC_Os05g04620.1 upstream_gene_variant ; 4510.0bp to feature; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0502167695 G -> A LOC_Os05g04600.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N
vg0502167695 G -> A LOC_Os05g04600-LOC_Os05g04610 intergenic_region ; MODIFIER silent_mutation Average:58.054; most accessible tissue: Zhenshan97 young leaf, score: 82.077 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502167695 G A 0.0 -0.01 -0.01 -0.02 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502167695 NA 7.32E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 NA 3.13E-06 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 NA 5.41E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 NA 7.27E-06 mr1863 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 6.47E-06 NA mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 1.69E-06 6.82E-07 mr1109_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 NA 5.30E-06 mr1826_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 8.43E-06 NA mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502167695 9.97E-07 2.78E-09 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251