Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502158078:

Variant ID: vg0502158078 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2158078
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TGCTTGGAAAAAACAGCATGAATGTTTCAGTGTTTTAGTGATTGTAAACACCTTGTAAAAATTCTGGTAGAAGCAACTGAGATACAATTTTTCAATGTTT[C/T]
AGTGTTTCAATTTCACACACAATTGCTGAATCATTAAAACACACAAGTTCATTACATAGGAGGCACCATTGCTGAATCACTAAAAAATTAGCATGAATTT

Reverse complement sequence

AAATTCATGCTAATTTTTTAGTGATTCAGCAATGGTGCCTCCTATGTAATGAACTTGTGTGTTTTAATGATTCAGCAATTGTGTGTGAAATTGAAACACT[G/A]
AAACATTGAAAAATTGTATCTCAGTTGCTTCTACCAGAATTTTTACAAGGTGTTTACAATCACTAAAACACTGAAACATTCATGCTGTTTTTTCCAAGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	11.10%	0.76%	0.21%	NA
All Indica	2759	80.90%	17.60%	1.16%	0.36%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	87.70%	11.90%	0.37%	0.00%	NA
Indica I	595	77.30%	19.00%	3.53%	0.17%	NA
Indica II	465	89.20%	10.50%	0.22%	0.00%	NA
Indica III	913	75.70%	23.30%	0.44%	0.55%	NA
Indica Intermediate	786	84.60%	14.10%	0.76%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	2.10%	3.12%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502158078	C -> T	LOC_Os05g04584-LOC_Os05g04600	intergenic_region ; MODIFIER	silent_mutation	Average:42.541; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N
vg0502158078	C -> DEL	N	N	silent_mutation	Average:42.541; most accessible tissue: Zhenshan97 flower, score: 69.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502158078	NA	7.94E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	NA	3.66E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	NA	8.66E-06	mr1289	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	8.11E-06	8.17E-08	mr1318	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	NA	8.71E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	NA	6.34E-07	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	NA	1.09E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502158078	NA	1.54E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251