\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502152922:

Variant ID: vg0502152922 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2152922
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGTTTGTGCAAGCTATGGTTGAGGATAGGATTTTTAGGTAATGCAAAGCAACTAGTAAGAGGATATGAGTGCTACTCATCTAAGTTATGAGCTCCATC[A/G]
TAGGTCTTACACATGGCGATGATTGAATCAACAACTTACATCACTGTGCTATAGGCGCCGTTGAAAATCCTGGTATTTCATTGAAGCCAAATACCCCAAG

Reverse complement sequence

CTTGGGGTATTTGGCTTCAATGAAATACCAGGATTTTCAACGGCGCCTATAGCACAGTGATGTAAGTTGTTGATTCAATCATCGCCATGTGTAAGACCTA[T/C]
GATGGAGCTCATAACTTAGATGAGTAGCACTCATATCCTCTTACTAGTTGCTTTGCATTACCTAAAAATCCTATCCTCAACCATAGCTTGCACAAACTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 42.10% 0.13% 0.00% NA
All Indica  2759 31.10% 68.90% 0.07% 0.00% NA
All Japonica  1512 98.50% 1.30% 0.26% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 3.90% 96.10% 0.00% 0.00% NA
Indica II  465 21.50% 78.50% 0.00% 0.00% NA
Indica III  913 54.20% 45.70% 0.11% 0.00% NA
Indica Intermediate  786 30.40% 69.50% 0.13% 0.00% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502152922 A -> G LOC_Os05g04584.1 downstream_gene_variant ; 2643.0bp to feature; MODIFIER silent_mutation Average:72.453; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N
vg0502152922 A -> G LOC_Os05g04584-LOC_Os05g04600 intergenic_region ; MODIFIER silent_mutation Average:72.453; most accessible tissue: Zhenshan97 young leaf, score: 94.554 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502152922 A G 0.01 -0.01 0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502152922 8.79E-07 7.31E-10 mr1119 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 1.42E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 3.74E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 1.16E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 1.68E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 6.85E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 6.45E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 7.93E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 3.17E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 2.88E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 2.76E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502152922 NA 2.93E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251