Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502139452:

Variant ID: vg0502139452 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2139452
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, T: 0.39, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTAATAATTAAATCTAGCAACATCAATTTTATATGATTGATTTTTTTTGCTATTAATAGTTAAAATTTAAAATGTTTGACTTGTCACTATGCTAAAAA[C/T]
ACTTATATTTTGGAACAGATGTAGTAGTTATATTTTGGGACGAAGATAGCAGTTGGGAAAACTTTCAGATGCCTCCATATCAGGAGACCATGCCTGCATG

Reverse complement sequence

CATGCAGGCATGGTCTCCTGATATGGAGGCATCTGAAAGTTTTCCCAACTGCTATCTTCGTCCCAAAATATAACTACTACATCTGTTCCAAAATATAAGT[G/A]
TTTTTAGCATAGTGACAAGTCAAACATTTTAAATTTTAACTATTAATAGCAAAAAAAATCAATCATATAAAATTGATGTTGCTAGATTTAATTATTACTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	42.30%	0.15%	0.04%	NA
All Indica	2759	78.10%	21.60%	0.14%	0.07%	NA
All Japonica	1512	16.10%	83.80%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.30%	0.00%	0.17%	NA
Indica II	465	83.00%	16.30%	0.43%	0.22%	NA
Indica III	913	57.30%	42.60%	0.11%	0.00%	NA
Indica Intermediate	786	83.30%	16.50%	0.13%	0.00%	NA
Temperate Japonica	767	5.10%	94.80%	0.13%	0.00%	NA
Tropical Japonica	504	29.40%	70.60%	0.00%	0.00%	NA
Japonica Intermediate	241	23.70%	76.30%	0.00%	0.00%	NA
VI/Aromatic	96	14.60%	85.40%	0.00%	0.00%	NA
Intermediate	90	37.80%	60.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502139452	C -> T	LOC_Os05g04584.1	upstream_gene_variant ; 4337.0bp to feature; MODIFIER	silent_mutation	Average:28.384; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg0502139452	C -> T	LOC_Os05g04570-LOC_Os05g04584	intergenic_region ; MODIFIER	silent_mutation	Average:28.384; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N
vg0502139452	C -> DEL	N	N	silent_mutation	Average:28.384; most accessible tissue: Zhenshan97 young leaf, score: 54.618	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502139452	NA	5.80E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	8.32E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	2.62E-13	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	5.11E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	2.34E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	5.87E-06	mr1030_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	2.50E-26	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	1.28E-06	NA	mr1218_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	2.63E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	3.87E-08	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	8.84E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	7.88E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502139452	NA	2.16E-06	mr1957_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251