\
| Variant ID: vg0502110672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2110672 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAATAACAAGATTCTTATCCCACCATCGCTAAAGCCGTTATGACGGTTGAGCATGTTTTGTCATTCACATCATATTTATAGAATGTAAGCTTCGATCTCT[C/T]
GTATGCCGAGAACTTTTCCACGAAGAGATCAATGTTGCGTAACGACAAATTAGTTGTTGACTTATCACACCCTACCCCATCTCACTACAAGATAAGAGCG
CGCTCTTATCTTGTAGTGAGATGGGGTAGGGTGTGATAAGTCAACAACTAATTTGTCGTTACGCAACATTGATCTCTTCGTGGAAAAGTTCTCGGCATAC[G/A]
AGAGATCGAAGCTTACATTCTATAAATATGATGTGAATGACAAAACATGCTCAACCGTCATAACGGCTTTAGCGATGGTGGGATAAGAATCTTGTTATTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 11.00% | 0.85% | 5.06% | NA |
| All Indica | 2759 | 79.90% | 14.60% | 1.20% | 4.24% | NA |
| All Japonica | 1512 | 90.70% | 1.30% | 0.26% | 7.74% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.90% | 9.90% | 0.86% | 2.37% | NA |
| Indica III | 913 | 58.10% | 30.70% | 1.86% | 9.42% | NA |
| Indica Intermediate | 786 | 86.00% | 9.90% | 1.53% | 2.54% | NA |
| Temperate Japonica | 767 | 96.90% | 1.00% | 0.26% | 1.83% | NA |
| Tropical Japonica | 504 | 81.00% | 1.60% | 0.40% | 17.06% | NA |
| Japonica Intermediate | 241 | 91.70% | 1.20% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 13.50% | 81.20% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 85.60% | 12.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502110672 | C -> T | LOC_Os05g04540.1 | upstream_gene_variant ; 581.0bp to feature; MODIFIER | silent_mutation | Average:36.849; most accessible tissue: Callus, score: 61.413 | N | N | N | N |
| vg0502110672 | C -> T | LOC_Os05g04550.1 | downstream_gene_variant ; 2922.0bp to feature; MODIFIER | silent_mutation | Average:36.849; most accessible tissue: Callus, score: 61.413 | N | N | N | N |
| vg0502110672 | C -> T | LOC_Os05g04530-LOC_Os05g04540 | intergenic_region ; MODIFIER | silent_mutation | Average:36.849; most accessible tissue: Callus, score: 61.413 | N | N | N | N |
| vg0502110672 | C -> DEL | N | N | silent_mutation | Average:36.849; most accessible tissue: Callus, score: 61.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502110672 | NA | 6.99E-06 | mr1030_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502110672 | NA | 2.88E-06 | mr1465_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502110672 | 1.26E-07 | 1.26E-07 | mr1468_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502110672 | 1.51E-06 | 2.17E-06 | mr1957_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502110672 | 1.78E-06 | 1.78E-06 | mr1957_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |