\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502110672:

Variant ID: vg0502110672 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2110672
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATAACAAGATTCTTATCCCACCATCGCTAAAGCCGTTATGACGGTTGAGCATGTTTTGTCATTCACATCATATTTATAGAATGTAAGCTTCGATCTCT[C/T]
GTATGCCGAGAACTTTTCCACGAAGAGATCAATGTTGCGTAACGACAAATTAGTTGTTGACTTATCACACCCTACCCCATCTCACTACAAGATAAGAGCG

Reverse complement sequence

CGCTCTTATCTTGTAGTGAGATGGGGTAGGGTGTGATAAGTCAACAACTAATTTGTCGTTACGCAACATTGATCTCTTCGTGGAAAAGTTCTCGGCATAC[G/A]
AGAGATCGAAGCTTACATTCTATAAATATGATGTGAATGACAAAACATGCTCAACCGTCATAACGGCTTTAGCGATGGTGGGATAAGAATCTTGTTATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 11.00% 0.85% 5.06% NA
All Indica  2759 79.90% 14.60% 1.20% 4.24% NA
All Japonica  1512 90.70% 1.30% 0.26% 7.74% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 86.90% 9.90% 0.86% 2.37% NA
Indica III  913 58.10% 30.70% 1.86% 9.42% NA
Indica Intermediate  786 86.00% 9.90% 1.53% 2.54% NA
Temperate Japonica  767 96.90% 1.00% 0.26% 1.83% NA
Tropical Japonica  504 81.00% 1.60% 0.40% 17.06% NA
Japonica Intermediate  241 91.70% 1.20% 0.00% 7.05% NA
VI/Aromatic  96 13.50% 81.20% 2.08% 3.12% NA
Intermediate  90 85.60% 12.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502110672 C -> T LOC_Os05g04540.1 upstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:36.849; most accessible tissue: Callus, score: 61.413 N N N N
vg0502110672 C -> T LOC_Os05g04550.1 downstream_gene_variant ; 2922.0bp to feature; MODIFIER silent_mutation Average:36.849; most accessible tissue: Callus, score: 61.413 N N N N
vg0502110672 C -> T LOC_Os05g04530-LOC_Os05g04540 intergenic_region ; MODIFIER silent_mutation Average:36.849; most accessible tissue: Callus, score: 61.413 N N N N
vg0502110672 C -> DEL N N silent_mutation Average:36.849; most accessible tissue: Callus, score: 61.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502110672 NA 6.99E-06 mr1030_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502110672 NA 2.88E-06 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502110672 1.26E-07 1.26E-07 mr1468_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502110672 1.51E-06 2.17E-06 mr1957_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502110672 1.78E-06 1.78E-06 mr1957_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251