\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502095253:

Variant ID: vg0502095253 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2095253
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATCTATCCATGCCACGTGTGTAAATCATGCCATAAGAACTGATATAATTTAATTTTATACCTCCCTGATGTCAAATTATACCCTAGAAATTTTGAAC[C/T]
TTCTAAACCTTCATATTGTTAGATTAATTTTTACCTTAACATAAGCCACGTTAGAGTGGAACCAACTTTTCAGACTCACGCAACGAGCTGCAATGATATT

Reverse complement sequence

AATATCATTGCAGCTCGTTGCGTGAGTCTGAAAAGTTGGTTCCACTCTAACGTGGCTTATGTTAAGGTAAAAATTAATCTAACAATATGAAGGTTTAGAA[G/A]
GTTCAAAATTTCTAGGGTATAATTTGACATCAGGGAGGTATAAAATTAAATTATATCAGTTCTTATGGCATGATTTACACACGTGGCATGGATAGATTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.30% 0.11% 0.00% NA
All Indica  2759 34.60% 65.20% 0.18% 0.00% NA
All Japonica  1512 95.70% 4.30% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 3.40% 96.50% 0.17% 0.00% NA
Indica II  465 25.20% 74.80% 0.00% 0.00% NA
Indica III  913 60.40% 39.60% 0.00% 0.00% NA
Indica Intermediate  786 33.80% 65.60% 0.51% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 93.70% 6.30% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502095253 C -> T LOC_Os05g04520.1 upstream_gene_variant ; 758.0bp to feature; MODIFIER silent_mutation Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392 N N N N
vg0502095253 C -> T LOC_Os05g04510.1 downstream_gene_variant ; 2911.0bp to feature; MODIFIER silent_mutation Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392 N N N N
vg0502095253 C -> T LOC_Os05g04510.2 downstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392 N N N N
vg0502095253 C -> T LOC_Os05g04510-LOC_Os05g04520 intergenic_region ; MODIFIER silent_mutation Average:65.674; most accessible tissue: Zhenshan97 root, score: 92.392 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502095253 C T 0.04 0.02 0.01 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502095253 NA 2.15E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 1.50E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 4.62E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 2.26E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 5.47E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 2.45E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 2.99E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 8.90E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 3.02E-06 4.77E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 1.16E-32 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 4.48E-10 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 9.02E-06 9.02E-06 mr1947_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502095253 NA 4.48E-10 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251