| Variant ID: vg0502049793 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 2049793 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTAGTTTGTGATAAAATAGTTGTTAAATCAATAGTTTTGTGATATAATACCTTAAATCTGTAGTTCCGTGATAAATTTGACTCTAAATCTGTAGTTTTGT[G/A]
AAATACATTCTTAAATCTGTAGTTTTGTAATAGTTTGATCAAAGTATCTGTAGTTTTGTTAAATTTACTCTTAAAATAAATTGTCTTGTGTTTTTTTTAA
TTAAAAAAAACACAAGACAATTTATTTTAAGAGTAAATTTAACAAAACTACAGATACTTTGATCAAACTATTACAAAACTACAGATTTAAGAATGTATTT[C/T]
ACAAAACTACAGATTTAGAGTCAAATTTATCACGGAACTACAGATTTAAGGTATTATATCACAAAACTATTGATTTAACAACTATTTTATCACAAACTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.70% | 0.40% | 2.41% | 64.47% | NA |
| All Indica | 2759 | 3.70% | 0.70% | 1.81% | 93.87% | NA |
| All Japonica | 1512 | 85.80% | 0.00% | 2.31% | 11.90% | NA |
| Aus | 269 | 4.80% | 0.00% | 8.55% | 86.62% | NA |
| Indica I | 595 | 2.20% | 1.30% | 3.03% | 93.45% | NA |
| Indica II | 465 | 4.10% | 0.90% | 1.72% | 93.33% | NA |
| Indica III | 913 | 2.40% | 0.00% | 0.99% | 96.60% | NA |
| Indica Intermediate | 786 | 6.00% | 0.80% | 1.91% | 91.35% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 0.13% | 3.26% | NA |
| Tropical Japonica | 504 | 72.80% | 0.00% | 3.97% | 23.21% | NA |
| Japonica Intermediate | 241 | 78.40% | 0.00% | 5.81% | 15.77% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 1.04% | 12.50% | NA |
| Intermediate | 90 | 58.90% | 0.00% | 5.56% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0502049793 | G -> DEL | N | N | silent_mutation | Average:27.841; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0502049793 | G -> A | LOC_Os05g04450.1 | upstream_gene_variant ; 701.0bp to feature; MODIFIER | silent_mutation | Average:27.841; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0502049793 | G -> A | LOC_Os05g04440.1 | downstream_gene_variant ; 3338.0bp to feature; MODIFIER | silent_mutation | Average:27.841; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0502049793 | G -> A | LOC_Os05g04460.1 | downstream_gene_variant ; 3681.0bp to feature; MODIFIER | silent_mutation | Average:27.841; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| vg0502049793 | G -> A | LOC_Os05g04440-LOC_Os05g04450 | intergenic_region ; MODIFIER | silent_mutation | Average:27.841; most accessible tissue: Zhenshan97 root, score: 68.908 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0502049793 | NA | 9.25E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502049793 | 8.89E-06 | NA | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502049793 | 4.66E-06 | 4.66E-06 | mr1682 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0502049793 | 9.01E-06 | 2.58E-13 | mr1666_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |