Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502049752:

Variant ID: vg0502049752 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2049752
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TATAAAATCTGTAGTTTTGTGATAAAATAGTTTTTAAATATGTAGTTTGTGATAAAATAGTTGTTAAATCAATAGTTTTGTGATATAATACCTTAAATCT[G/A]
TAGTTCCGTGATAAATTTGACTCTAAATCTGTAGTTTTGTGAAATACATTCTTAAATCTGTAGTTTTGTAATAGTTTGATCAAAGTATCTGTAGTTTTGT

Reverse complement sequence

ACAAAACTACAGATACTTTGATCAAACTATTACAAAACTACAGATTTAAGAATGTATTTCACAAAACTACAGATTTAGAGTCAAATTTATCACGGAACTA[C/T]
AGATTTAAGGTATTATATCACAAAACTATTGATTTAACAACTATTTTATCACAAACTACATATTTAAAAACTATTTTATCACAAAACTACAGATTTTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.20%	0.80%	3.60%	63.37%	NA
All Indica	2759	4.30%	1.10%	2.39%	92.21%	NA
All Japonica	1512	83.30%	0.00%	5.29%	11.38%	NA
Aus	269	4.50%	3.00%	5.95%	86.62%	NA
Indica I	595	3.50%	1.80%	2.69%	91.93%	NA
Indica II	465	4.70%	1.70%	2.37%	91.18%	NA
Indica III	913	2.50%	0.10%	2.41%	94.96%	NA
Indica Intermediate	786	6.60%	1.40%	2.16%	89.82%	NA
Temperate Japonica	767	96.20%	0.00%	0.65%	3.13%	NA
Tropical Japonica	504	66.70%	0.00%	12.10%	21.23%	NA
Japonica Intermediate	241	77.20%	0.00%	5.81%	17.01%	NA
VI/Aromatic	96	86.50%	0.00%	1.04%	12.50%	NA
Intermediate	90	54.40%	0.00%	7.78%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502049752	G -> DEL	N	N	silent_mutation	Average:24.622; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0502049752	G -> A	LOC_Os05g04450.1	upstream_gene_variant ; 742.0bp to feature; MODIFIER	silent_mutation	Average:24.622; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0502049752	G -> A	LOC_Os05g04440.1	downstream_gene_variant ; 3297.0bp to feature; MODIFIER	silent_mutation	Average:24.622; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0502049752	G -> A	LOC_Os05g04460.1	downstream_gene_variant ; 3722.0bp to feature; MODIFIER	silent_mutation	Average:24.622; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N
vg0502049752	G -> A	LOC_Os05g04440-LOC_Os05g04450	intergenic_region ; MODIFIER	silent_mutation	Average:24.622; most accessible tissue: Zhenshan97 root, score: 66.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502049752	NA	9.14E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502049752	NA	2.66E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502049752	1.13E-06	4.93E-14	mr1666_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502049752	NA	1.10E-09	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251