Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502032617:

Variant ID: vg0502032617 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 2032617
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATCCTGAGATTTAGTCGGTTACGATTGTATTTTATTTGTATTCTCGTATTCTGATAAGGATATGAGTTATACCTTGTAATACAGACTCCTTCCCCTATA[T/C,G]
AAGGAGGGGTCCGAGTCCTTCCTGGGACACCAATTCTCTTTGAGATCATACATTCAATAATACACTCGGCGGTTTCCACCCCGGACAGGAGTAGGGTATT

Reverse complement sequence

AATACCCTACTCCTGTCCGGGGTGGAAACCGCCGAGTGTATTATTGAATGTATGATCTCAAAGAGAATTGGTGTCCCAGGAAGGACTCGGACCCCTCCTT[A/G,C]
TATAGGGGAAGGAGTCTGTATTACAAGGTATAACTCATATCCTTATCAGAATACGAGAATACAAATAAAATACAATCGTAACCGACTAAATCTCAGGATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.90%	7.90%	2.35%	21.84%	NA
All Indica	2759	57.70%	10.40%	3.01%	28.89%	NA
All Japonica	1512	87.60%	0.80%	0.33%	11.31%	NA
Aus	269	56.10%	18.20%	5.95%	19.70%	NA
Indica I	595	49.40%	15.50%	4.20%	30.92%	NA
Indica II	465	64.50%	3.40%	1.29%	30.75%	NA
Indica III	913	60.40%	9.50%	3.40%	26.73%	NA
Indica Intermediate	786	56.70%	11.80%	2.67%	28.75%	NA
Temperate Japonica	767	97.30%	0.30%	0.26%	2.22%	NA
Tropical Japonica	504	75.40%	1.00%	0.20%	23.41%	NA
Japonica Intermediate	241	82.20%	2.10%	0.83%	14.94%	NA
VI/Aromatic	96	67.70%	21.90%	6.25%	4.17%	NA
Intermediate	90	87.80%	3.30%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0502032617	T -> DEL	N	N	silent_mutation	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N
vg0502032617	T -> G	LOC_Os05g04420.1	upstream_gene_variant ; 262.0bp to feature; MODIFIER	N	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N
vg0502032617	T -> G	LOC_Os05g04410.1	downstream_gene_variant ; 2414.0bp to feature; MODIFIER	N	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N
vg0502032617	T -> G	LOC_Os05g04410-LOC_Os05g04420	intergenic_region ; MODIFIER	N	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N
vg0502032617	T -> C	LOC_Os05g04420.1	upstream_gene_variant ; 262.0bp to feature; MODIFIER	silent_mutation	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N
vg0502032617	T -> C	LOC_Os05g04410.1	downstream_gene_variant ; 2414.0bp to feature; MODIFIER	silent_mutation	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N
vg0502032617	T -> C	LOC_Os05g04410-LOC_Os05g04420	intergenic_region ; MODIFIER	silent_mutation	Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0502032617	4.62E-06	2.22E-06	mr1946	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502032617	6.81E-06	NA	mr1748_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251