\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502032617:

Variant ID: vg0502032617 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2032617
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATCCTGAGATTTAGTCGGTTACGATTGTATTTTATTTGTATTCTCGTATTCTGATAAGGATATGAGTTATACCTTGTAATACAGACTCCTTCCCCTATA[T/C,G]
AAGGAGGGGTCCGAGTCCTTCCTGGGACACCAATTCTCTTTGAGATCATACATTCAATAATACACTCGGCGGTTTCCACCCCGGACAGGAGTAGGGTATT

Reverse complement sequence

AATACCCTACTCCTGTCCGGGGTGGAAACCGCCGAGTGTATTATTGAATGTATGATCTCAAAGAGAATTGGTGTCCCAGGAAGGACTCGGACCCCTCCTT[A/G,C]
TATAGGGGAAGGAGTCTGTATTACAAGGTATAACTCATATCCTTATCAGAATACGAGAATACAAATAAAATACAATCGTAACCGACTAAATCTCAGGATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 7.90% 2.35% 21.84% NA
All Indica  2759 57.70% 10.40% 3.01% 28.89% NA
All Japonica  1512 87.60% 0.80% 0.33% 11.31% NA
Aus  269 56.10% 18.20% 5.95% 19.70% NA
Indica I  595 49.40% 15.50% 4.20% 30.92% NA
Indica II  465 64.50% 3.40% 1.29% 30.75% NA
Indica III  913 60.40% 9.50% 3.40% 26.73% NA
Indica Intermediate  786 56.70% 11.80% 2.67% 28.75% NA
Temperate Japonica  767 97.30% 0.30% 0.26% 2.22% NA
Tropical Japonica  504 75.40% 1.00% 0.20% 23.41% NA
Japonica Intermediate  241 82.20% 2.10% 0.83% 14.94% NA
VI/Aromatic  96 67.70% 21.90% 6.25% 4.17% NA
Intermediate  90 87.80% 3.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502032617 T -> DEL N N silent_mutation Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0502032617 T -> G LOC_Os05g04420.1 upstream_gene_variant ; 262.0bp to feature; MODIFIER N Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0502032617 T -> G LOC_Os05g04410.1 downstream_gene_variant ; 2414.0bp to feature; MODIFIER N Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0502032617 T -> G LOC_Os05g04410-LOC_Os05g04420 intergenic_region ; MODIFIER N Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0502032617 T -> C LOC_Os05g04420.1 upstream_gene_variant ; 262.0bp to feature; MODIFIER silent_mutation Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0502032617 T -> C LOC_Os05g04410.1 downstream_gene_variant ; 2414.0bp to feature; MODIFIER silent_mutation Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N
vg0502032617 T -> C LOC_Os05g04410-LOC_Os05g04420 intergenic_region ; MODIFIER silent_mutation Average:5.389; most accessible tissue: Zhenshan97 flag leaf, score: 7.948 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502032617 4.62E-06 2.22E-06 mr1946 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502032617 6.81E-06 NA mr1748_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251