\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0502008041:

Variant ID: vg0502008041 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 2008041
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCGAGAAGCCAGAAGCTAAACCAATAGACCAGTAGAAAGTTGCTTTGTATTTTTTTCAAAATTCTTGTACCCCCTCATGTTCCTACTATGTGACACCA[T/C]
TTGTCGGTGAACCTTCGCTTTTTCTCTCCTTCTATAATGAAATTGGCAGAGCACCTGCCCCTTCCTAAAAAAAAATATCACTTTTATATATCATACATAT

Reverse complement sequence

ATATGTATGATATATAAAAGTGATATTTTTTTTTAGGAAGGGGCAGGTGCTCTGCCAATTTCATTATAGAAGGAGAGAAAAAGCGAAGGTTCACCGACAA[A/G]
TGGTGTCACATAGTAGGAACATGAGGGGGTACAAGAATTTTGAAAAAAATACAAAGCAACTTTCTACTGGTCTATTGGTTTAGCTTCTGGCTTCTCGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 33.80% 0.00% 0.00% NA
All Indica  2759 94.20% 5.80% 0.00% 0.00% NA
All Japonica  1512 8.00% 92.00% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 88.00% 12.00% 0.00% 0.00% NA
Indica III  913 94.90% 5.10% 0.00% 0.00% NA
Indica Intermediate  786 93.30% 6.70% 0.00% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 11.90% 88.10% 0.00% 0.00% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0502008041 T -> C LOC_Os05g04380.1 upstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:56.398; most accessible tissue: Callus, score: 90.69 N N N N
vg0502008041 T -> C LOC_Os05g04380.2 upstream_gene_variant ; 2074.0bp to feature; MODIFIER silent_mutation Average:56.398; most accessible tissue: Callus, score: 90.69 N N N N
vg0502008041 T -> C LOC_Os05g04370-LOC_Os05g04380 intergenic_region ; MODIFIER silent_mutation Average:56.398; most accessible tissue: Callus, score: 90.69 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0502008041 T C 0.03 0.1 0.09 0.06 0.07 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0502008041 NA 1.33E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.32E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.58E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.61E-24 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 9.30E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.98E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 2.35E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.79E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 6.67E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.31E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.08E-27 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.25E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.20E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 5.44E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 2.42E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.97E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.91E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 5.26E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.36E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 7.21E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.22E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.74E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.88E-59 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.56E-25 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.34E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 2.80E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.82E-68 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 7.60E-09 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 2.75E-30 mr1903 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.25E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.98E-82 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 2.28E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.24E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.59E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.04E-81 mr1934 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.02E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.29E-54 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.03E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.55E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 6.12E-10 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.83E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 9.71E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.89E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.96E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.64E-22 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.40E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 6.69E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 4.89E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.89E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 1.51E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.11E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 5.21E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 2.77E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.10E-16 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 7.18E-64 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 7.39E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0502008041 NA 3.39E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251