\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501988258:

Variant ID: vg0501988258 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1988258
Reference Allele: CAlternative Allele: G,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, G: 0.39, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGCAAAAACTCTAGATCGATAAAAATCCAAAGAAGAAAACAAGGCTCTGATACCACTTGTAGGATCGAATCACAAGAACTAAGCCAACCAGAGGGGG[C/G,A]
TGAATGGTTGCTATACCCAAAAACCGAAAACTTTTAGCGGAAATAAAAGTTACCCTCAATTTCGATGAGATCGGTCTGACCGGAGTAGATTAGCCGGTCT

Reverse complement sequence

AGACCGGCTAATCTACTCCGGTCAGACCGATCTCATCGAAATTGAGGGTAACTTTTATTTCCGCTAAAAGTTTTCGGTTTTTGGGTATAGCAACCATTCA[G/C,T]
CCCCCTCTGGTTGGCTTAGTTCTTGTGATTCGATCCTACAAGTGGTATCAGAGCCTTGTTTTCTTCTTTGGATTTTTATCGATCTAGAGTTTTTGCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.00% 14.60% 36.63% 15.70% A: 0.02%
All Indica  2759 4.50% 16.30% 53.10% 26.02% A: 0.04%
All Japonica  1512 91.10% 1.20% 7.01% 0.66% NA
Aus  269 1.50% 74.70% 23.05% 0.74% NA
Indica I  595 4.00% 3.50% 56.47% 35.97% NA
Indica II  465 6.20% 9.90% 49.68% 33.98% A: 0.22%
Indica III  913 2.50% 31.90% 52.03% 13.58% NA
Indica Intermediate  786 6.10% 11.80% 53.82% 28.24% NA
Temperate Japonica  767 98.30% 0.00% 1.17% 0.52% NA
Tropical Japonica  504 85.30% 3.20% 10.91% 0.60% NA
Japonica Intermediate  241 80.50% 0.80% 17.43% 1.24% NA
VI/Aromatic  96 4.20% 14.60% 81.25% 0.00% NA
Intermediate  90 56.70% 7.80% 22.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501988258 C -> DEL N N silent_mutation Average:35.845; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0501988258 C -> G LOC_Os05g04350.1 upstream_gene_variant ; 98.0bp to feature; MODIFIER silent_mutation Average:35.845; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0501988258 C -> G LOC_Os05g04350-LOC_Os05g04360 intergenic_region ; MODIFIER silent_mutation Average:35.845; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0501988258 C -> A LOC_Os05g04350.1 upstream_gene_variant ; 98.0bp to feature; MODIFIER silent_mutation Average:35.845; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N
vg0501988258 C -> A LOC_Os05g04350-LOC_Os05g04360 intergenic_region ; MODIFIER silent_mutation Average:35.845; most accessible tissue: Zhenshan97 root, score: 54.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501988258 NA 1.75E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.07E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.29E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.17E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 4.22E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 6.96E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.25E-10 mr1275 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.08E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.77E-27 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 4.25E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 3.86E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 9.44E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 6.41E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 7.95E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.81E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.09E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.71E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.32E-60 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 6.90E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 5.73E-23 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.07E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 6.44E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.55E-33 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.50E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.16E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.08E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.88E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 3.09E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 5.48E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 2.16E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 3.64E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.99E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501988258 NA 1.70E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251