Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0501973478:

Variant ID: vg0501973478 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1973478
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGTAAACTCATCCATGGGCATGGATTCCAACCAGTTTTTTGAGTATGTTCGTGTTGTTCAAAGAGTGAAGCATATAATGGGTCGGCTCCAGGTGAGGG[C/T]
GCATGAATCTGCTCGACATCGACATCGCTCTCCATCAAATTGACTTGTCTGGCCTTGTAGGATGGTGTAGCATTAGCATAGCATCATGTGGATCTGTAGG

Reverse complement sequence

CCTACAGATCCACATGATGCTATGCTAATGCTACACCATCCTACAAGGCCAGACAAGTCAATTTGATGGAGAGCGATGTCGATGTCGAGCAGATTCATGC[G/A]
CCCTCACCTGGAGCCGACCCATTATATGCTTCACTCTTTGAACAACACGAACATACTCAAAAAACTGGTTGGAATCCATGCCCATGGATGAGTTTACTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.70% 0.11% 0.00% NA
All Indica  2759 49.20% 50.70% 0.11% 0.00% NA
All Japonica  1512 92.60% 7.30% 0.07% 0.00% NA
Aus  269 12.30% 87.70% 0.00% 0.00% NA
Indica I  595 30.60% 69.20% 0.17% 0.00% NA
Indica II  465 31.40% 68.60% 0.00% 0.00% NA
Indica III  913 77.70% 22.20% 0.11% 0.00% NA
Indica Intermediate  786 40.80% 59.00% 0.13% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.10% 0.20% 0.00% NA
Japonica Intermediate  241 82.20% 17.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501973478 C -> T LOC_Os05g04330.1 missense_variant ; p.Ala667Val; MODERATE nonsynonymous_codon ; A667V Average:75.799; most accessible tissue: Zhenshan97 flower, score: 95.542 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501973478 C T 0.0 0.01 0.01 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501973478 NA 6.76E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 1.68E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 1.13E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 4.85E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 2.52E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 3.03E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 6.41E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 3.56E-17 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 5.40E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 9.93E-07 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501973478 NA 2.39E-06 mr1965_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251