\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501905548:

Variant ID: vg0501905548 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 1905548
Reference Allele: TAlternative Allele: C,TA
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATGTATACATAAAAATATATTTAACAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAAATTTTTAAATAAGATAAATGTTTAAACATATT[T/C,TA]
AAAAAAGTCAACGGCGTCTAACATTTAGAAATGAAGTATATGTTTTTAATTTCGATTACACATCAAACACACAGTACCACTACTATACGCACGCGCACTC

Reverse complement sequence

GAGTGCGCGTGCGTATAGTAGTGGTACTGTGTGTTTGATGTGTAATCGAAATTAAAAACATATACTTCATTTCTAAATGTTAGACGCCGTTGACTTTTTT[A/G,TA]
AATATGTTTAAACATTTATCTTATTTAAAAATTTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGTTAAATATATTTTTATGTATACATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.30% 3.20% 0.15% 0.00% TA: 0.30%
All Indica  2759 94.40% 5.30% 0.25% 0.00% NA
All Japonica  1512 99.00% 0.10% 0.00% 0.00% TA: 0.93%
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 91.80% 8.20% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 4.30% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 0.00% 0.00% 0.00% TA: 2.78%
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501905548 T -> TA LOC_Os05g04215.1 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:46.42; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0501905548 T -> TA LOC_Os05g04210.1 downstream_gene_variant ; 2366.0bp to feature; MODIFIER silent_mutation Average:46.42; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0501905548 T -> TA LOC_Os05g04190-LOC_Os05g04210 intergenic_region ; MODIFIER silent_mutation Average:46.42; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0501905548 T -> C LOC_Os05g04215.1 upstream_gene_variant ; 4794.0bp to feature; MODIFIER silent_mutation Average:46.42; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0501905548 T -> C LOC_Os05g04210.1 downstream_gene_variant ; 2367.0bp to feature; MODIFIER silent_mutation Average:46.42; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0501905548 T -> C LOC_Os05g04190-LOC_Os05g04210 intergenic_region ; MODIFIER silent_mutation Average:46.42; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501905548 4.77E-06 NA mr1713 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501905548 NA 2.60E-06 mr1713 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501905548 NA 9.55E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501905548 NA 2.54E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501905548 NA 6.86E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251