\
| Variant ID: vg0501904125 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1904125 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATATCTCCGTTGATTCTTAAGGACGGTTTTATTTTTGATATTTTCATGCTTGAGGAGGCATTGAGAGATACATACTCCATCTATAATTTTTAAAAGTGT[C/A]
TTTTTAGTTATAAACCTGAACTCTCTTTTAGGGACGGAGCTAGCTAGGGGGTATTTTATTGTATTAAGTTTGGCACCTATGGGTAGATGTGATCGTAAAA
TTTTACGATCACATCTACCCATAGGTGCCAAACTTAATACAATAAAATACCCCCTAGCTAGCTCCGTCCCTAAAAGAGAGTTCAGGTTTATAACTAAAAA[G/T]
ACACTTTTAAAAATTATAGATGGAGTATGTATCTCTCAATGCCTCCTCAAGCATGAAAATATCAAAAATAAAACCGTCCTTAAGAATCAACGGAGATATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 16.10% | 0.00% | 0.02% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 57.40% | 42.50% | 0.00% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 75.20% | 24.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 37.90% | 61.90% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 41.50% | 58.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 82.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 20.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501904125 | C -> DEL | N | N | silent_mutation | Average:44.889; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0501904125 | C -> A | LOC_Os05g04210.1 | downstream_gene_variant ; 3790.0bp to feature; MODIFIER | silent_mutation | Average:44.889; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0501904125 | C -> A | LOC_Os05g04190-LOC_Os05g04210 | intergenic_region ; MODIFIER | silent_mutation | Average:44.889; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501904125 | 7.90E-06 | 6.91E-08 | mr1269 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501904125 | NA | 7.48E-07 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501904125 | NA | 5.67E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501904125 | NA | 2.53E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501904125 | NA | 7.85E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501904125 | NA | 7.85E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501904125 | NA | 9.43E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |