RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0501865585:

Variant ID: vg0501865585 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1865585
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTGAGGATGGAAAGGTACATGATGCACTTTCTATGTGGCATTGGATGGTGGATGAAGGATGGGCTCCATCAACAATCTCTTACAATGTTCTCATCC[G/A]
TGGCCTTTGCTGCATTGGTGATTTGAAAGGAGCATTAGATTTCTTCAACAGTATGAAAAGAAATGCCCTCCTTCCCAACGCGACTACCTATTCTACGCTT

Reverse complement sequence

AAGCGTAGAATAGGTAGTCGCGTTGGGAAGGAGGGCATTTCTTTTCATACTGTTGAAGAAATCTAATGCTCCTTTCAAATCACCAATGCAGCAAAGGCCA[C/T]
GGATGAGAACATTGTAAGAGATTGTTGATGGAGCCCATCCTTCATCCACCATCCAATGCCACATAGAAAGTGCATCATGTACCTTTCCATCCTCAAAAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.70%	9.30%	0.00%	0.00%	NA
All Indica	2759	85.30%	14.70%	0.00%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	72.80%	27.20%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	84.80%	15.20%	0.00%	0.00%	NA
Indica Intermediate	786	88.50%	11.50%	0.00%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501865585	G -> A	LOC_Os05g04160.1	missense_variant ; p.Arg335His; MODERATE	nonsynonymous_codon ; R335H	Average:56.173; most accessible tissue: Zhenshan97 flower, score: 83.709	probably damaging	2.33	TOLERATED	1.00

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501865585	NA	4.61E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585	NA	4.43E-06	mr1925	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585	4.84E-06	NA	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585	NA	3.49E-08	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585	NA	3.48E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585	NA	6.88E-07	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0501865585:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact