\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501865585:

Variant ID: vg0501865585 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1865585
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTGAGGATGGAAAGGTACATGATGCACTTTCTATGTGGCATTGGATGGTGGATGAAGGATGGGCTCCATCAACAATCTCTTACAATGTTCTCATCC[G/A]
TGGCCTTTGCTGCATTGGTGATTTGAAAGGAGCATTAGATTTCTTCAACAGTATGAAAAGAAATGCCCTCCTTCCCAACGCGACTACCTATTCTACGCTT

Reverse complement sequence

AAGCGTAGAATAGGTAGTCGCGTTGGGAAGGAGGGCATTTCTTTTCATACTGTTGAAGAAATCTAATGCTCCTTTCAAATCACCAATGCAGCAAAGGCCA[C/T]
GGATGAGAACATTGTAAGAGATTGTTGATGGAGCCCATCCTTCATCCACCATCCAATGCCACATAGAAAGTGCATCATGTACCTTTCCATCCTCAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 9.30% 0.00% 0.00% NA
All Indica  2759 85.30% 14.70% 0.00% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 72.80% 27.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 84.80% 15.20% 0.00% 0.00% NA
Indica Intermediate  786 88.50% 11.50% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501865585 G -> A LOC_Os05g04160.1 missense_variant ; p.Arg335His; MODERATE nonsynonymous_codon ; R335H Average:56.173; most accessible tissue: Zhenshan97 flower, score: 83.709 probably damaging 2.33 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501865585 NA 4.61E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585 NA 4.43E-06 mr1925 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585 4.84E-06 NA mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585 NA 3.49E-08 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585 NA 3.48E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501865585 NA 6.88E-07 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251