\
| Variant ID: vg0501839750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1839750 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCGGCCGACAGGCAGCGGTCAGATCAGCTCTATGAACGAAACCCGACTCTTTTCAAACTTTGGCAATATTCTCCTATTTTAATCCTAAGTGCTAAATTT[A/G]
GGTGTAAACACATGCCTCCTGCCTTTTTGTGAACTTTGTGAACCTAAAAGCATAAAACACGTGATCTTAGGGCAATAATCTAATTGCCGGCCATATAACT
AGTTATATGGCCGGCAATTAGATTATTGCCCTAAGATCACGTGTTTTATGCTTTTAGGTTCACAAAGTTCACAAAAAGGCAGGAGGCATGTGTTTACACC[T/C]
AAATTTAGCACTTAGGATTAAAATAGGAGAATATTGCCAAAGTTTGAAAAGAGTCGGGTTTCGTTCATAGAGCTGATCTGACCGCTGCCTGTCGGCCGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.20% | 22.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 50.90% | 49.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 3.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 27.00% | 73.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 27.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501839750 | A -> G | LOC_Os05g04080.1 | upstream_gene_variant ; 924.0bp to feature; MODIFIER | silent_mutation | Average:30.645; most accessible tissue: Callus, score: 73.019 | N | N | N | N |
| vg0501839750 | A -> G | LOC_Os05g04100.1 | upstream_gene_variant ; 3102.0bp to feature; MODIFIER | silent_mutation | Average:30.645; most accessible tissue: Callus, score: 73.019 | N | N | N | N |
| vg0501839750 | A -> G | LOC_Os05g04090.1 | downstream_gene_variant ; 866.0bp to feature; MODIFIER | silent_mutation | Average:30.645; most accessible tissue: Callus, score: 73.019 | N | N | N | N |
| vg0501839750 | A -> G | LOC_Os05g04110.1 | downstream_gene_variant ; 4390.0bp to feature; MODIFIER | silent_mutation | Average:30.645; most accessible tissue: Callus, score: 73.019 | N | N | N | N |
| vg0501839750 | A -> G | LOC_Os05g04080-LOC_Os05g04090 | intergenic_region ; MODIFIER | silent_mutation | Average:30.645; most accessible tissue: Callus, score: 73.019 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501839750 | NA | 3.29E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 1.72E-11 | mr1045 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 3.46E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 7.27E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 2.00E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 7.36E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 1.27E-07 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 7.09E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 1.96E-10 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 1.34E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501839750 | NA | 1.04E-08 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |