\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501839750:

Variant ID: vg0501839750 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1839750
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGGCCGACAGGCAGCGGTCAGATCAGCTCTATGAACGAAACCCGACTCTTTTCAAACTTTGGCAATATTCTCCTATTTTAATCCTAAGTGCTAAATTT[A/G]
GGTGTAAACACATGCCTCCTGCCTTTTTGTGAACTTTGTGAACCTAAAAGCATAAAACACGTGATCTTAGGGCAATAATCTAATTGCCGGCCATATAACT

Reverse complement sequence

AGTTATATGGCCGGCAATTAGATTATTGCCCTAAGATCACGTGTTTTATGCTTTTAGGTTCACAAAGTTCACAAAAAGGCAGGAGGCATGTGTTTACACC[T/C]
AAATTTAGCACTTAGGATTAAAATAGGAGAATATTGCCAAAGTTTGAAAAGAGTCGGGTTTCGTTCATAGAGCTGATCTGACCGCTGCCTGTCGGCCGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 22.70% 0.08% 0.00% NA
All Indica  2759 97.80% 2.00% 0.14% 0.00% NA
All Japonica  1512 50.90% 49.10% 0.00% 0.00% NA
Aus  269 11.90% 88.10% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 95.10% 4.70% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.20% 0.25% 0.00% NA
Temperate Japonica  767 27.00% 73.00% 0.00% 0.00% NA
Tropical Japonica  504 74.60% 25.40% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501839750 A -> G LOC_Os05g04080.1 upstream_gene_variant ; 924.0bp to feature; MODIFIER silent_mutation Average:30.645; most accessible tissue: Callus, score: 73.019 N N N N
vg0501839750 A -> G LOC_Os05g04100.1 upstream_gene_variant ; 3102.0bp to feature; MODIFIER silent_mutation Average:30.645; most accessible tissue: Callus, score: 73.019 N N N N
vg0501839750 A -> G LOC_Os05g04090.1 downstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:30.645; most accessible tissue: Callus, score: 73.019 N N N N
vg0501839750 A -> G LOC_Os05g04110.1 downstream_gene_variant ; 4390.0bp to feature; MODIFIER silent_mutation Average:30.645; most accessible tissue: Callus, score: 73.019 N N N N
vg0501839750 A -> G LOC_Os05g04080-LOC_Os05g04090 intergenic_region ; MODIFIER silent_mutation Average:30.645; most accessible tissue: Callus, score: 73.019 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501839750 NA 3.29E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 1.72E-11 mr1045 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 3.46E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 7.27E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 2.00E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 7.36E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 1.27E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 7.09E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 1.96E-10 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 1.34E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501839750 NA 1.04E-08 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251