\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501809225:

Variant ID: vg0501809225 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1809225
Reference Allele: TAlternative Allele: A,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGCGCGTGGGGAGTTGGAACCAGTCCTGCAGCATATACCACATCGCCATGACTATCAGCTTGTGCCTCTTCCTCCGCCGCATCGTCTTGTCGTCGTCC[T/A,C]
TGGCGACGCGGCGCGTGATCTTGCCCAGGAAGGTCTGCGGCGTGAGGTGGTAGAAGATCTCCTCCAGCACGAAGAAGGGGATCTGGTTCTCCAGCAGGCC

Reverse complement sequence

GGCCTGCTGGAGAACCAGATCCCCTTCTTCGTGCTGGAGGAGATCTTCTACCACCTCACGCCGCAGACCTTCCTGGGCAAGATCACGCGCCGCGTCGCCA[A/T,G]
GGACGACGACAAGACGATGCGGCGGAGGAAGAGGCACAAGCTGATAGTCATGGCGATGTGGTATATGCTGCAGGACTGGTTCCAACTCCCCACGCGCGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.80% 26.30% 2.62% 41.11% C: 1.25%
All Indica  2759 14.30% 13.20% 3.01% 67.38% C: 2.14%
All Japonica  1512 45.20% 49.60% 2.25% 2.91% NA
Aus  269 88.50% 3.70% 0.37% 7.43% NA
Indica I  595 0.50% 3.50% 1.51% 94.45% NA
Indica II  465 12.50% 14.40% 3.23% 67.31% C: 2.58%
Indica III  913 25.80% 18.40% 3.50% 49.95% C: 2.30%
Indica Intermediate  786 12.30% 13.70% 3.44% 67.18% C: 3.31%
Temperate Japonica  767 25.30% 73.50% 0.26% 0.91% NA
Tropical Japonica  504 68.30% 25.20% 3.97% 2.58% NA
Japonica Intermediate  241 60.60% 24.50% 4.98% 9.96% NA
VI/Aromatic  96 9.40% 88.50% 1.04% 1.04% NA
Intermediate  90 37.80% 35.60% 5.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501809225 T -> DEL LOC_Os05g04020.1 N frameshift_variant Average:44.357; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0501809225 T -> C LOC_Os05g04020.1 missense_variant ; p.Lys240Arg; MODERATE nonsynonymous_codon ; K240R Average:44.357; most accessible tissue: Minghui63 young leaf, score: 90.17 unknown unknown TOLERATED 0.58
vg0501809225 T -> A LOC_Os05g04020.1 missense_variant ; p.Lys240Met; MODERATE nonsynonymous_codon ; K240V Average:44.357; most accessible tissue: Minghui63 young leaf, score: 90.17 benign 1.21 TOLERATED 0.33
vg0501809225 T -> A LOC_Os05g04020.1 missense_variant ; p.Lys240Met; MODERATE nonsynonymous_codon ; K240M Average:44.357; most accessible tissue: Minghui63 young leaf, score: 90.17 unknown unknown TOLERATED 0.13

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501809225 T A 0.02 0.01 0.01 0.01 0.02 0.02
vg0501809225 T C 0.03 0.01 0.01 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501809225 NA 4.88E-06 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 1.42E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 5.73E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 4.64E-08 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 7.72E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 2.91E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 7.14E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 1.41E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 2.82E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 2.72E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 6.74E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 5.79E-07 6.01E-10 mr1113_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 9.75E-07 2.99E-09 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 1.40E-06 9.88E-10 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 2.72E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 1.88E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 2.48E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 6.26E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 6.15E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809225 NA 8.72E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251