\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501809181:

Variant ID: vg0501809181 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1809181
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTGGACCTCCTCCTCGGCGATGAGCTTGTACAGATCGTCGCTCTCGCGCGTGGGGAGTTGGAACCAGTCCTGCAGCATATACCACATCGCCATGACTA[T/G]
CAGCTTGTGCCTCTTCCTCCGCCGCATCGTCTTGTCGTCGTCCTTGGCGACGCGGCGCGTGATCTTGCCCAGGAAGGTCTGCGGCGTGAGGTGGTAGAAG

Reverse complement sequence

CTTCTACCACCTCACGCCGCAGACCTTCCTGGGCAAGATCACGCGCCGCGTCGCCAAGGACGACGACAAGACGATGCGGCGGAGGAAGAGGCACAAGCTG[A/C]
TAGTCATGGCGATGTGGTATATGCTGCAGGACTGGTTCCAACTCCCCACGCGCGAGAGCGACGATCTGTACAAGCTCATCGCCGAGGAGGAGGTCCACCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 1.30% 2.24% 38.66% NA
All Indica  2759 31.00% 2.20% 2.65% 64.12% NA
All Japonica  1512 97.00% 0.00% 1.79% 1.19% NA
Aus  269 92.60% 0.00% 0.00% 7.43% NA
Indica I  595 7.10% 0.00% 1.18% 91.76% NA
Indica II  465 29.70% 2.20% 3.44% 64.73% NA
Indica III  913 50.30% 2.80% 3.07% 43.81% NA
Indica Intermediate  786 27.60% 3.20% 2.80% 66.41% NA
Temperate Japonica  767 99.10% 0.00% 0.00% 0.91% NA
Tropical Japonica  504 95.80% 0.00% 2.98% 1.19% NA
Japonica Intermediate  241 92.90% 0.00% 4.98% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 73.30% 0.00% 5.56% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501809181 T -> DEL LOC_Os05g04020.1 N frameshift_variant Average:47.272; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0501809181 T -> G LOC_Os05g04020.1 missense_variant ; p.Ile255Leu; MODERATE nonsynonymous_codon ; I255L Average:47.272; most accessible tissue: Minghui63 young leaf, score: 90.17 benign -0.278 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501809181 T G 0.0 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501809181 NA 8.49E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 1.20E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 2.01E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 1.23E-06 2.21E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 9.41E-06 7.99E-06 mr1030_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 4.75E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 7.87E-06 NA mr1331_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 4.83E-06 mr1444_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 9.95E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 5.32E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 1.10E-07 8.50E-11 mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 9.71E-07 2.74E-07 mr1754_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 2.19E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 1.77E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 1.09E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 1.09E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 3.29E-06 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 NA 7.06E-06 mr1957_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 5.58E-06 NA mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809181 7.67E-06 7.67E-06 mr1965_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251