Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501809094:

Variant ID: vg0501809094 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1809094
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCACAGCTGCCACTCGCATGGCGGAGACTTGGGGCCGGCGCTATCGACCTTGGCGAGGTGAGCTATGTGCACCAGGTGCAGCAGGTGGTGGACCTCCT[C/T]
CTCGGCGATGAGCTTGTACAGATCGTCGCTCTCGCGCGTGGGGAGTTGGAACCAGTCCTGCAGCATATACCACATCGCCATGACTATCAGCTTGTGCCTC

Reverse complement sequence

GAGGCACAAGCTGATAGTCATGGCGATGTGGTATATGCTGCAGGACTGGTTCCAACTCCCCACGCGCGAGAGCGACGATCTGTACAAGCTCATCGCCGAG[G/A]
AGGAGGTCCACCACCTGCTGCACCTGGTGCACATAGCTCACCTCGCCAAGGTCGATAGCGCCGGCCCCAAGTCTCCGCCATGCGAGTGGCAGCTGTGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 14.70% 0.74% 35.27% NA
All Indica  2759 39.70% 0.90% 0.98% 58.43% NA
All Japonica  1512 55.40% 43.10% 0.40% 1.12% NA
Aus  269 92.60% 0.00% 0.00% 7.43% NA
Indica I  595 4.00% 0.30% 1.51% 94.12% NA
Indica II  465 36.30% 1.30% 1.08% 61.29% NA
Indica III  913 68.50% 0.30% 0.33% 30.89% NA
Indica Intermediate  786 35.40% 1.70% 1.27% 61.70% NA
Temperate Japonica  767 74.30% 24.60% 0.13% 0.91% NA
Tropical Japonica  504 34.30% 63.70% 0.79% 1.19% NA
Japonica Intermediate  241 39.00% 58.90% 0.41% 1.66% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 60.00% 18.90% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501809094 C -> T LOC_Os05g04020.1 missense_variant ; p.Glu284Lys; MODERATE nonsynonymous_codon ; E284K Average:48.225; most accessible tissue: Minghui63 young leaf, score: 88.629 unknown unknown TOLERATED 0.42
vg0501809094 C -> DEL LOC_Os05g04020.1 N frameshift_variant Average:48.225; most accessible tissue: Minghui63 young leaf, score: 88.629 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501809094 C T -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501809094 NA 1.12E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 NA 8.34E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 NA 6.15E-06 mr1775 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 NA 7.97E-06 mr1030_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 NA 7.20E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 NA 5.31E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 4.67E-06 4.45E-08 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501809094 1.41E-06 1.36E-07 mr1957_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251