\
| Variant ID: vg0501807710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1807710 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGTTGCATAGCCGCCGACGGTTGACGGAACTTCTAGAAAATAAAAAATGAATTCCAACGATAGTTATGTTCGATTTTTAGAATCACAATGACAATAAAGA[C/G]
TAGGCGGCGGACGGGCCGTAAAGGAGCATAGTGCCATTGTTTGACGAGACTTCTAAAAATTATAAAAAATAAAACTCAACAAGACAATTAACTCTAAAAA
TTTTTAGAGTTAATTGTCTTGTTGAGTTTTATTTTTTATAATTTTTAGAAGTCTCGTCAAACAATGGCACTATGCTCCTTTACGGCCCGTCCGCCGCCTA[G/C]
TCTTTATTGTCATTGTGATTCTAAAAATCGAACATAACTATCGTTGGAATTCATTTTTTATTTTCTAGAAGTTCCGTCAACCGTCGGCGGCTATGCAACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 8.90% | 3.05% | 36.80% | NA |
| All Indica | 2759 | 72.70% | 0.20% | 1.09% | 26.02% | NA |
| All Japonica | 1512 | 17.50% | 26.70% | 6.35% | 49.54% | NA |
| Aus | 269 | 9.70% | 0.00% | 4.83% | 85.50% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 78.10% | 0.20% | 0.86% | 20.86% | NA |
| Indica III | 913 | 49.50% | 0.20% | 1.86% | 48.41% | NA |
| Indica Intermediate | 786 | 76.30% | 0.00% | 0.89% | 22.77% | NA |
| Temperate Japonica | 767 | 16.80% | 47.70% | 9.91% | 25.55% | NA |
| Tropical Japonica | 504 | 19.60% | 2.60% | 2.38% | 75.40% | NA |
| Japonica Intermediate | 241 | 14.90% | 10.00% | 3.32% | 71.78% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 45.60% | 12.20% | 5.56% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501807710 | C -> DEL | N | N | silent_mutation | Average:16.859; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0501807710 | C -> G | LOC_Os05g04020.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.859; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501807710 | NA | 1.41E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0501807710 | NA | 2.98E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | 3.37E-06 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 7.73E-11 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 1.31E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 5.11E-10 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 3.43E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 6.54E-06 | mr1359_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 2.31E-07 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 2.13E-11 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 6.75E-07 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 3.86E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 1.43E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 2.47E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501807710 | NA | 8.79E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |