\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501807593:

Variant ID: vg0501807593 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1807593
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTACCGGGACTTTTAGAAAGTAAAAAAAAATAAACCTCATTGATAATCATATTCGATTTTTAAAATCTCAATGACAATAAAAAGGAGAAGCAGCGGGC[G/A,T]
GGGTGTATAGGAGTATAGTTGCATAGCCGCCGACGGTTGACGGAACTTCTAGAAAATAAAAAATGAATTCCAACGATAGTTATGTTCGATTTTTAGAATC

Reverse complement sequence

GATTCTAAAAATCGAACATAACTATCGTTGGAATTCATTTTTTATTTTCTAGAAGTTCCGTCAACCGTCGGCGGCTATGCAACTATACTCCTATACACCC[C/T,A]
GCCCGCTGCTTCTCCTTTTTATTGTCATTGAGATTTTAAAAATCGAATATGATTATCAATGAGGTTTATTTTTTTTTACTTTCTAAAAGTCCCGGTAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 7.70% 4.89% 7.32% T: 0.06%
All Indica  2759 87.20% 9.70% 1.49% 1.63% NA
All Japonica  1512 68.10% 0.50% 12.04% 19.38% NA
Aus  269 94.80% 1.90% 1.86% 0.37% T: 1.12%
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 86.90% 9.90% 1.51% 1.72% NA
Indica III  913 79.20% 16.20% 1.64% 2.96% NA
Indica Intermediate  786 88.00% 8.40% 2.29% 1.27% NA
Temperate Japonica  767 80.10% 0.10% 8.74% 11.08% NA
Tropical Japonica  504 57.70% 0.20% 14.68% 27.38% NA
Japonica Intermediate  241 51.90% 2.10% 17.01% 29.05% NA
VI/Aromatic  96 14.60% 84.40% 1.04% 0.00% NA
Intermediate  90 84.40% 5.60% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501807593 G -> T LOC_Os05g04020.1 intron_variant ; MODIFIER silent_mutation Average:17.054; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0501807593 G -> DEL N N silent_mutation Average:17.054; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0501807593 G -> A LOC_Os05g04020.1 intron_variant ; MODIFIER silent_mutation Average:17.054; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501807593 NA 2.07E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 6.96E-09 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 5.79E-06 5.79E-06 mr1356 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 7.32E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 7.60E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 5.16E-06 mr1552 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 5.84E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 8.05E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 3.01E-06 2.56E-07 mr1713 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 8.07E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 4.33E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501807593 NA 2.97E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251