\
| Variant ID: vg0501804785 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1804785 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, T: 0.15, others allele: 0.00, population size: 94. )
ATATGACATATATTTAGTGTAAAAGTTGAAATTTATAACGTAATTATAGTGTAAACGTATTTATTTAAACTTTTTCTTGGAAAATATGCACCATAAATAT[A/T]
GTTAGTCTTTTTCTAACCAGTTTTGCTGAAAACATGTGCCATATTTTTAGTTGATTACGGTCACTTATTTCTCAGCACCGAATCTAGTATGTGGAAAAAG
CTTTTTCCACATACTAGATTCGGTGCTGAGAAATAAGTGACCGTAATCAACTAAAAATATGGCACATGTTTTCAGCAAAACTGGTTAGAAAAAGACTAAC[T/A]
ATATTTATGGTGCATATTTTCCAAGAAAAAGTTTAAATAAATACGTTTACACTATAATTACGTTATAAATTTCAACTTTTACACTAAATATATGTCATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 41.10% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 33.10% | 66.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.10% | 2.60% | 0.33% | 0.00% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 31.60% | 68.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.30% | 44.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 31.60% | 68.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.10% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501804785 | A -> T | LOC_Os05g04010.1 | upstream_gene_variant ; 4610.0bp to feature; MODIFIER | silent_mutation | Average:21.177; most accessible tissue: Callus, score: 61.805 | N | N | N | N |
| vg0501804785 | A -> T | LOC_Os05g04020.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.177; most accessible tissue: Callus, score: 61.805 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501804785 | NA | 1.50E-15 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | 2.89E-06 | 1.47E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | 4.85E-06 | 4.44E-06 | mr1030_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 4.99E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 5.77E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 1.15E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 9.93E-07 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | 1.49E-06 | 9.37E-18 | mr1578_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 8.13E-09 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 4.20E-06 | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 1.18E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 1.64E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 1.43E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | NA | 1.43E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | 5.40E-06 | NA | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501804785 | 4.80E-06 | 4.58E-08 | mr1952_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |