| Variant ID: vg0501802982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1802982 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGGTCGGAAATGATCGGAAAACAGCCTCAACCATTTCCGTAACCATATTTTTCTCGGAAACGAAATCGGAAACGGTAAAGTCGGAAACGAAAACGATATC[G/A]
GAAATATCGGAAAACCGAAAACGGAACAATACGGACGGAAACATGTCGGTACAGATCGAAAACCGGTAACAAATACGGAAACATTAAACTATAAAAACAT
ATGTTTTTATAGTTTAATGTTTCCGTATTTGTTACCGGTTTTCGATCTGTACCGACATGTTTCCGTCCGTATTGTTCCGTTTTCGGTTTTCCGATATTTC[C/T]
GATATCGTTTTCGTTTCCGACTTTACCGTTTCCGATTTCGTTTCCGAGAAAAATATGGTTACGGAAATGGTTGAGGCTGTTTTCCGATCATTTCCGACCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 2.10% | 14.92% | 44.22% | NA |
| All Indica | 2759 | 28.20% | 3.60% | 17.25% | 51.00% | NA |
| All Japonica | 1512 | 52.40% | 0.10% | 5.95% | 41.53% | NA |
| Aus | 269 | 55.40% | 0.00% | 38.29% | 6.32% | NA |
| Indica I | 595 | 16.30% | 2.50% | 25.55% | 55.63% | NA |
| Indica II | 465 | 28.40% | 1.30% | 17.63% | 52.69% | NA |
| Indica III | 913 | 38.30% | 6.10% | 12.16% | 43.37% | NA |
| Indica Intermediate | 786 | 25.30% | 2.70% | 16.67% | 55.34% | NA |
| Temperate Japonica | 767 | 74.10% | 0.00% | 1.83% | 24.12% | NA |
| Tropical Japonica | 504 | 30.60% | 0.00% | 8.93% | 60.52% | NA |
| Japonica Intermediate | 241 | 29.50% | 0.40% | 12.86% | 57.26% | NA |
| VI/Aromatic | 96 | 68.80% | 2.10% | 26.04% | 3.12% | NA |
| Intermediate | 90 | 48.90% | 0.00% | 12.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501802982 | G -> DEL | N | N | silent_mutation | Average:14.352; most accessible tissue: Callus, score: 28.079 | N | N | N | N |
| vg0501802982 | G -> A | LOC_Os05g04010.1 | upstream_gene_variant ; 2807.0bp to feature; MODIFIER | silent_mutation | Average:14.352; most accessible tissue: Callus, score: 28.079 | N | N | N | N |
| vg0501802982 | G -> A | LOC_Os05g04020.1 | downstream_gene_variant ; 1200.0bp to feature; MODIFIER | silent_mutation | Average:14.352; most accessible tissue: Callus, score: 28.079 | N | N | N | N |
| vg0501802982 | G -> A | LOC_Os05g04010-LOC_Os05g04020 | intergenic_region ; MODIFIER | silent_mutation | Average:14.352; most accessible tissue: Callus, score: 28.079 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501802982 | 2.10E-07 | 1.29E-10 | mr1514 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501802982 | 2.41E-06 | 4.90E-07 | mr1514 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501802982 | NA | 4.70E-06 | mr1772 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501802982 | NA | 1.49E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501802982 | NA | 7.52E-06 | mr1906_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501802982 | NA | 4.94E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |