\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501791123:

Variant ID: vg0501791123 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1791123
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGCGCGTACGCTTCCTCCTTGTTGATGGCGCGCACCTGCTCCGGGACTCGCCACAGACGGTACTTCTTCGTCTTCCACCGGAACGACAGCGACGATGG[C/T]
GGGAGGTCGCCGCCATCGTCGTTGTCGTCGTGGATTATGTTCACCCTCACCTCCGGCAGCTGCTGCTGCCCTGCCTCGTCCAGAAAAACCATTTCTGTAG

Reverse complement sequence

CTACAGAAATGGTTTTTCTGGACGAGGCAGGGCAGCAGCAGCTGCCGGAGGTGAGGGTGAACATAATCCACGACGACAACGACGATGGCGGCGACCTCCC[G/A]
CCATCGTCGCTGTCGTTCCGGTGGAAGACGAAGAAGTACCGTCTGTGGCGAGTCCCGGAGCAGGTGCGCGCCATCAACAAGGAGGAAGCGTACGCGCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 37.50% 4.04% 6.56% NA
All Indica  2759 21.90% 61.90% 6.13% 10.08% NA
All Japonica  1512 96.50% 1.30% 0.13% 2.05% NA
Aus  269 90.70% 7.80% 1.49% 0.00% NA
Indica I  595 0.30% 98.50% 0.17% 1.01% NA
Indica II  465 18.30% 66.70% 5.38% 9.68% NA
Indica III  913 39.00% 32.50% 11.72% 16.76% NA
Indica Intermediate  786 20.50% 65.50% 4.58% 9.41% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 97.20% 1.40% 0.00% 1.39% NA
Japonica Intermediate  241 87.60% 2.10% 0.41% 9.96% NA
VI/Aromatic  96 85.40% 3.10% 11.46% 0.00% NA
Intermediate  90 71.10% 22.20% 5.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501791123 C -> T LOC_Os05g03972.1 synonymous_variant ; p.Pro51Pro; LOW synonymous_codon Average:49.905; most accessible tissue: Zhenshan97 flower, score: 76.324 N N N N
vg0501791123 C -> DEL LOC_Os05g03972.1 N frameshift_variant Average:49.905; most accessible tissue: Zhenshan97 flower, score: 76.324 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501791123 C T 0.03 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501791123 NA 2.20E-32 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 9.24E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 1.02E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 2.96E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 5.24E-08 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 6.16E-09 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 4.71E-06 NA mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 1.25E-07 3.52E-10 mr1120 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 2.36E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 7.49E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 6.31E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 1.82E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 3.30E-08 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 7.03E-08 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 2.63E-08 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 3.48E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 5.19E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501791123 NA 1.59E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251