\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501786396:

Variant ID: vg0501786396 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1786396
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAGGACGGCGCCTTTGTCGTCGTCGACATTGACGAGGTGGGCGTGGGCGAGGTGCAGCAGGTGCAGCAGGTGGTGGACCTCCTTGTCGGCGATGAGCT[T/C]
GTACAGCTCGTCGCTCTCGTCCTCGGGGAGGACGAACCACCCCTTGAGCATGTACCACATCGCCATGACCAGCAGCTTGTGCCTCTTCCTCTGCCGCATC

Reverse complement sequence

GATGCGGCAGAGGAAGAGGCACAAGCTGCTGGTCATGGCGATGTGGTACATGCTCAAGGGGTGGTTCGTCCTCCCCGAGGACGAGAGCGACGAGCTGTAC[A/G]
AGCTCATCGCCGACAAGGAGGTCCACCACCTGCTGCACCTGCTGCACCTCGCCCACGCCCACCTCGTCAATGTCGACGACGACAAAGGCGCCGTCCTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 8.10% 5.65% 19.23% NA
All Indica  2759 79.00% 1.30% 5.80% 13.88% NA
All Japonica  1512 58.90% 3.60% 4.03% 33.53% NA
Aus  269 13.40% 73.20% 13.38% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 82.40% 2.40% 4.30% 10.97% NA
Indica III  913 62.10% 1.10% 12.49% 24.32% NA
Indica Intermediate  786 80.80% 1.90% 3.31% 13.99% NA
Temperate Japonica  767 80.70% 0.70% 3.39% 15.25% NA
Tropical Japonica  504 35.50% 6.70% 3.77% 53.97% NA
Japonica Intermediate  241 38.20% 6.20% 6.64% 48.96% NA
VI/Aromatic  96 8.30% 90.60% 1.04% 0.00% NA
Intermediate  90 56.70% 12.20% 10.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501786396 T -> DEL LOC_Os05g03972.1 N frameshift_variant Average:65.119; most accessible tissue: Zhenshan97 flag leaf, score: 97.021 N N N N
vg0501786396 T -> C LOC_Os05g03972.1 missense_variant ; p.Lys289Glu; MODERATE nonsynonymous_codon ; K289E Average:65.119; most accessible tissue: Zhenshan97 flag leaf, score: 97.021 benign 0.259 TOLERATED 0.97

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501786396 T C 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501786396 NA 2.30E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 2.89E-06 1.75E-08 mr1117 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 1.67E-08 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 3.15E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 4.39E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 3.58E-06 NA mr1401 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 5.63E-06 mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 2.25E-14 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 4.88E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 4.15E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 7.13E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 6.61E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 5.11E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501786396 NA 9.01E-08 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251