Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501783564:

Variant ID: vg0501783564 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1783564
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.08, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GCATGTATACCTAACGGTACCAAATATGATACCCTGTAGGTATCGATGATACCCCGTCAGTACTAGCTCCGGGTACCTATTAGTACCGGGCCGATATCCT[A/G]
TTTAGAGATGGCAACGGGGCTGCCCCCACCAGGTAATGCTAACCCACCTGTCCCAAATACCTGAAAATCGAACTTTAGAATCAGAGAACACAACAAGCAA

Reverse complement sequence

TTGCTTGTTGTGTTCTCTGATTCTAAAGTTCGATTTTCAGGTATTTGGGACAGGTGGGTTAGCATTACCTGGTGGGGGCAGCCCCGTTGCCATCTCTAAA[T/C]
AGGATATCGGCCCGGTACTAATAGGTACCCGGAGCTAGTACTGACGGGGTATCATCGATACCTACAGGGTATCATATTTGGTACCGTTAGGTATACATGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.60% 25.90% 4.91% 39.63% NA
All Indica  2759 7.50% 18.80% 7.97% 65.75% NA
All Japonica  1512 59.80% 38.80% 0.20% 1.19% NA
Aus  269 88.50% 3.70% 0.37% 7.43% NA
Indica I  595 1.20% 1.80% 0.50% 96.47% NA
Indica II  465 11.20% 14.00% 4.95% 69.89% NA
Indica III  913 6.20% 35.90% 15.22% 42.61% NA
Indica Intermediate  786 11.60% 14.50% 7.00% 66.92% NA
Temperate Japonica  767 83.40% 15.30% 0.39% 0.91% NA
Tropical Japonica  504 37.10% 61.70% 0.00% 1.19% NA
Japonica Intermediate  241 32.00% 66.00% 0.00% 2.07% NA
VI/Aromatic  96 14.60% 83.30% 1.04% 1.04% NA
Intermediate  90 40.00% 30.00% 7.78% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501783564 A -> DEL N N silent_mutation Average:44.729; most accessible tissue: Minghui63 young leaf, score: 93.306 N N N N
vg0501783564 A -> G LOC_Os05g03960.1 downstream_gene_variant ; 1189.0bp to feature; MODIFIER silent_mutation Average:44.729; most accessible tissue: Minghui63 young leaf, score: 93.306 N N N N
vg0501783564 A -> G LOC_Os05g03972.1 downstream_gene_variant ; 1572.0bp to feature; MODIFIER silent_mutation Average:44.729; most accessible tissue: Minghui63 young leaf, score: 93.306 N N N N
vg0501783564 A -> G LOC_Os05g03960-LOC_Os05g03972 intergenic_region ; MODIFIER silent_mutation Average:44.729; most accessible tissue: Minghui63 young leaf, score: 93.306 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501783564 A G -0.01 0.01 0.0 -0.03 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501783564 NA 3.17E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501783564 NA 8.45E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501783564 NA 1.77E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501783564 NA 8.35E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501783564 3.48E-07 9.54E-13 mr1751 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501783564 NA 3.44E-06 mr1751 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501783564 NA 1.40E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251