\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501780326:

Variant ID: vg0501780326 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1780326
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


CCCAAATCTTAAGTTACATATACACACAAATCAAATACATCACAAATCCTAAAAAAATACGCACAAATCAGATACATCAAAAATCCTAAAAAATAACACA[C/T]
AAATTAAATACATCACAGATTATACATCTCAGATCCATGCAATGAATCACAAAATTATACATCTCAATTAATCACAAATTATCCAAAAAAAAGAGAGGAT

Reverse complement sequence

ATCCTCTCTTTTTTTTGGATAATTTGTGATTAATTGAGATGTATAATTTTGTGATTCATTGCATGGATCTGAGATGTATAATCTGTGATGTATTTAATTT[G/A]
TGTGTTATTTTTTAGGATTTTTGATGTATCTGATTTGTGCGTATTTTTTTAGGATTTGTGATGTATTTGATTTGTGTGTATATGTAACTTAAGATTTGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 24.30% 0.97% 17.03% NA
All Indica  2759 64.30% 29.70% 0.29% 5.76% NA
All Japonica  1512 52.20% 4.60% 1.92% 41.34% NA
Aus  269 10.80% 88.10% 1.12% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 68.40% 28.00% 0.00% 3.66% NA
Indica III  913 37.00% 50.20% 0.44% 12.38% NA
Indica Intermediate  786 67.60% 28.20% 0.51% 3.69% NA
Temperate Japonica  767 68.80% 0.50% 1.56% 29.07% NA
Tropical Japonica  504 33.10% 8.70% 2.58% 55.56% NA
Japonica Intermediate  241 39.00% 8.70% 1.66% 50.62% NA
VI/Aromatic  96 90.60% 7.30% 2.08% 0.00% NA
Intermediate  90 52.20% 20.00% 4.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501780326 C -> T LOC_Os05g03960.1 upstream_gene_variant ; 1815.0bp to feature; MODIFIER silent_mutation Average:48.796; most accessible tissue: Minghui63 young leaf, score: 97.588 N N N N
vg0501780326 C -> T LOC_Os05g03950.1 downstream_gene_variant ; 2667.0bp to feature; MODIFIER silent_mutation Average:48.796; most accessible tissue: Minghui63 young leaf, score: 97.588 N N N N
vg0501780326 C -> T LOC_Os05g03972.1 downstream_gene_variant ; 4810.0bp to feature; MODIFIER silent_mutation Average:48.796; most accessible tissue: Minghui63 young leaf, score: 97.588 N N N N
vg0501780326 C -> T LOC_Os05g03950-LOC_Os05g03960 intergenic_region ; MODIFIER silent_mutation Average:48.796; most accessible tissue: Minghui63 young leaf, score: 97.588 N N N N
vg0501780326 C -> DEL N N silent_mutation Average:48.796; most accessible tissue: Minghui63 young leaf, score: 97.588 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501780326 C T -0.01 -0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501780326 NA 1.71E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 1.72E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 6.53E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 1.42E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 8.15E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 3.80E-06 NA mr1754_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 6.00E-06 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 7.37E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 NA 8.64E-09 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780326 3.09E-06 1.42E-09 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251