\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501780039:

Variant ID: vg0501780039 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1780039
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTTACTCCCAGTTGATAACCCCCTATAGTACTCCCAGTTGATAACCCCCTATAGTTCCGGTTTTTCAACCGAGAGTAAAAATCTGGGACTAAAGATA[G/A]
TGATCTTTAGTCCCGGTTCAAATACTCAGGACAAAAGATGGATAGCGGCAGTCAGATGGTCCCCTTTTCTTTTTTTTTTCATTTTTATTGTTTCTTTGGC

Reverse complement sequence

GCCAAAGAAACAATAAAAATGAAAAAAAAAAGAAAAGGGGACCATCTGACTGCCGCTATCCATCTTTTGTCCTGAGTATTTGAACCGGGACTAAAGATCA[C/T]
TATCTTTAGTCCCAGATTTTTACTCTCGGTTGAAAAACCGGAACTATAGGGGGTTATCAACTGGGAGTACTATAGGGGGTTATCAACTGGGAGTAAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 35.00% 0.78% 23.02% NA
All Indica  2759 31.40% 48.40% 0.76% 19.39% NA
All Japonica  1512 62.00% 2.40% 0.93% 34.66% NA
Aus  269 1.90% 94.40% 0.00% 3.72% NA
Indica I  595 1.50% 77.80% 0.50% 20.17% NA
Indica II  465 27.30% 52.00% 0.22% 20.43% NA
Indica III  913 55.40% 23.20% 0.66% 20.70% NA
Indica Intermediate  786 28.60% 53.30% 1.40% 16.67% NA
Temperate Japonica  767 83.40% 1.00% 0.52% 14.99% NA
Tropical Japonica  504 36.70% 4.40% 0.79% 58.13% NA
Japonica Intermediate  241 46.90% 2.50% 2.49% 48.13% NA
VI/Aromatic  96 87.50% 9.40% 1.04% 2.08% NA
Intermediate  90 57.80% 22.20% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501780039 G -> DEL N N silent_mutation Average:60.651; most accessible tissue: Minghui63 young leaf, score: 99.354 N N N N
vg0501780039 G -> A LOC_Os05g03960.1 upstream_gene_variant ; 2102.0bp to feature; MODIFIER silent_mutation Average:60.651; most accessible tissue: Minghui63 young leaf, score: 99.354 N N N N
vg0501780039 G -> A LOC_Os05g03950.1 downstream_gene_variant ; 2380.0bp to feature; MODIFIER silent_mutation Average:60.651; most accessible tissue: Minghui63 young leaf, score: 99.354 N N N N
vg0501780039 G -> A LOC_Os05g03950-LOC_Os05g03960 intergenic_region ; MODIFIER silent_mutation Average:60.651; most accessible tissue: Minghui63 young leaf, score: 99.354 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501780039 G A -0.02 -0.07 -0.06 -0.02 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501780039 NA 1.73E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0501780039 NA 6.59E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 5.94E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 9.55E-06 3.00E-09 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 1.19E-06 8.92E-07 mr1030_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 4.11E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 1.42E-06 mr1527_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 6.08E-06 mr1544_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 5.42E-07 6.90E-07 mr1578_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 3.57E-06 2.18E-09 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 7.71E-06 mr1754_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 1.62E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 4.66E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 1.30E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 3.43E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 4.76E-07 1.06E-09 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 3.37E-06 mr1957_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501780039 NA 8.44E-06 mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251