Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501779956:

Variant ID: vg0501779956 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1779956
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 34. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTCCATTTTGCACCATCTCCTCGTCGTGGTCCCGATCGATACCGCTATTGTGGCCGCGAAACCGACACTGGTGGAGAAACCCTTTTTACTCCCAGTTG[A/G]
TAACCCCCTATAGTACTCCCAGTTGATAACCCCCTATAGTTCCGGTTTTTCAACCGAGAGTAAAAATCTGGGACTAAAGATAGTGATCTTTAGTCCCGGT

Reverse complement sequence

ACCGGGACTAAAGATCACTATCTTTAGTCCCAGATTTTTACTCTCGGTTGAAAAACCGGAACTATAGGGGGTTATCAACTGGGAGTACTATAGGGGGTTA[T/C]
CAACTGGGAGTAAAAAGGGTTTCTCCACCAGTGTCGGTTTCGCGGCCACAATAGCGGTATCGATCGGGACCACGACGAGGAGATGGTGCAAAATGGAGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 14.60% 0.17% 14.88% NA
All Indica  2759 69.70% 24.40% 0.11% 5.76% NA
All Japonica  1512 64.60% 0.10% 0.20% 35.19% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 75.90% 20.60% 0.00% 3.44% NA
Indica III  913 42.10% 45.30% 0.33% 12.27% NA
Indica Intermediate  786 76.20% 19.80% 0.00% 3.94% NA
Temperate Japonica  767 85.30% 0.00% 0.00% 14.73% NA
Tropical Japonica  504 40.90% 0.20% 0.40% 58.53% NA
Japonica Intermediate  241 48.10% 0.00% 0.41% 51.45% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 75.60% 8.90% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501779956 A -> DEL N N silent_mutation Average:63.096; most accessible tissue: Minghui63 young leaf, score: 99.585 N N N N
vg0501779956 A -> G LOC_Os05g03960.1 upstream_gene_variant ; 2185.0bp to feature; MODIFIER silent_mutation Average:63.096; most accessible tissue: Minghui63 young leaf, score: 99.585 N N N N
vg0501779956 A -> G LOC_Os05g03950.1 downstream_gene_variant ; 2297.0bp to feature; MODIFIER silent_mutation Average:63.096; most accessible tissue: Minghui63 young leaf, score: 99.585 N N N N
vg0501779956 A -> G LOC_Os05g03950-LOC_Os05g03960 intergenic_region ; MODIFIER silent_mutation Average:63.096; most accessible tissue: Minghui63 young leaf, score: 99.585 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501779956 A G -0.07 0.0 -0.02 0.0 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501779956 1.38E-06 NA mr1030_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 NA 4.98E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 NA 1.97E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 NA 1.64E-06 mr1544_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 1.77E-06 NA mr1578_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 3.07E-06 2.32E-06 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 NA 1.77E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 NA 2.37E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 5.05E-08 7.35E-11 mr1952_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 5.02E-07 1.69E-10 mr1952_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501779956 5.40E-06 NA mr1965_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251