\
| Variant ID: vg0501764750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 1764750 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 78. )
CCCAAATCCACAATAGTCTCGGTTCCATTAAAAACCGGGACTAAAAAAACATTTTTAGTCCCGGTTTATAACTGTAAGGGGACTATATCATCTTTAATCC[C/T]
GGTTCGTGTTATCAACCGAGACTAAAAATCATCTTTAGTCCAGGACTAAAGATGATCTTTAGTCCCCGTTCATGTCGTGTCAGAGGCTGCTAGTCCCTAG
CTAGGGACTAGCAGCCTCTGACACGACATGAACGGGGACTAAAGATCATCTTTAGTCCTGGACTAAAGATGATTTTTAGTCTCGGTTGATAACACGAACC[G/A]
GGATTAAAGATGATATAGTCCCCTTACAGTTATAAACCGGGACTAAAAATGTTTTTTTAGTCCCGGTTTTTAATGGAACCGAGACTATTGTGGATTTGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.60% | 9.20% | 1.10% | 9.16% | NA |
| All Indica | 2759 | 82.50% | 13.60% | 1.23% | 2.65% | NA |
| All Japonica | 1512 | 72.60% | 3.10% | 1.06% | 23.21% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.30% | 9.90% | 0.65% | 2.15% | NA |
| Indica III | 913 | 64.70% | 27.80% | 2.41% | 5.04% | NA |
| Indica Intermediate | 786 | 87.20% | 9.50% | 1.15% | 2.16% | NA |
| Temperate Japonica | 767 | 88.40% | 0.30% | 0.78% | 10.56% | NA |
| Tropical Japonica | 504 | 55.00% | 5.60% | 1.39% | 38.10% | NA |
| Japonica Intermediate | 241 | 59.30% | 7.10% | 1.24% | 32.37% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 12.20% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0501764750 | C -> T | LOC_Os05g03940.1 | upstream_gene_variant ; 1933.0bp to feature; MODIFIER | silent_mutation | Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0501764750 | C -> T | LOC_Os05g03934.1 | downstream_gene_variant ; 1994.0bp to feature; MODIFIER | silent_mutation | Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0501764750 | C -> T | LOC_Os05g03934-LOC_Os05g03940 | intergenic_region ; MODIFIER | silent_mutation | Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0501764750 | C -> DEL | N | N | silent_mutation | Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0501764750 | NA | 4.93E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | NA | 9.27E-06 | mr1401 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | 4.64E-06 | 4.64E-06 | mr1312_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | 4.47E-06 | 4.47E-06 | mr1663_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | 9.18E-06 | 9.18E-06 | mr1669_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | 4.01E-06 | 4.01E-06 | mr1688_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | 9.21E-06 | 9.21E-06 | mr1697_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | NA | 1.74E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0501764750 | 5.00E-06 | 3.54E-08 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |