\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501764750:

Variant ID: vg0501764750 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1764750
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CCCAAATCCACAATAGTCTCGGTTCCATTAAAAACCGGGACTAAAAAAACATTTTTAGTCCCGGTTTATAACTGTAAGGGGACTATATCATCTTTAATCC[C/T]
GGTTCGTGTTATCAACCGAGACTAAAAATCATCTTTAGTCCAGGACTAAAGATGATCTTTAGTCCCCGTTCATGTCGTGTCAGAGGCTGCTAGTCCCTAG

Reverse complement sequence

CTAGGGACTAGCAGCCTCTGACACGACATGAACGGGGACTAAAGATCATCTTTAGTCCTGGACTAAAGATGATTTTTAGTCTCGGTTGATAACACGAACC[G/A]
GGATTAAAGATGATATAGTCCCCTTACAGTTATAAACCGGGACTAAAAATGTTTTTTTAGTCCCGGTTTTTAATGGAACCGAGACTATTGTGGATTTGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.60% 9.20% 1.10% 9.16% NA
All Indica  2759 82.50% 13.60% 1.23% 2.65% NA
All Japonica  1512 72.60% 3.10% 1.06% 23.21% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 87.30% 9.90% 0.65% 2.15% NA
Indica III  913 64.70% 27.80% 2.41% 5.04% NA
Indica Intermediate  786 87.20% 9.50% 1.15% 2.16% NA
Temperate Japonica  767 88.40% 0.30% 0.78% 10.56% NA
Tropical Japonica  504 55.00% 5.60% 1.39% 38.10% NA
Japonica Intermediate  241 59.30% 7.10% 1.24% 32.37% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 12.20% 2.22% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501764750 C -> T LOC_Os05g03940.1 upstream_gene_variant ; 1933.0bp to feature; MODIFIER silent_mutation Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0501764750 C -> T LOC_Os05g03934.1 downstream_gene_variant ; 1994.0bp to feature; MODIFIER silent_mutation Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0501764750 C -> T LOC_Os05g03934-LOC_Os05g03940 intergenic_region ; MODIFIER silent_mutation Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0501764750 C -> DEL N N silent_mutation Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501764750 NA 4.93E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 NA 9.27E-06 mr1401 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 4.64E-06 4.64E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 4.47E-06 4.47E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 9.18E-06 9.18E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 4.01E-06 4.01E-06 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 9.21E-06 9.21E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 NA 1.74E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750 5.00E-06 3.54E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251