Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501764750:

Variant ID: vg0501764750 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1764750
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

CCCAAATCCACAATAGTCTCGGTTCCATTAAAAACCGGGACTAAAAAAACATTTTTAGTCCCGGTTTATAACTGTAAGGGGACTATATCATCTTTAATCC[C/T]
GGTTCGTGTTATCAACCGAGACTAAAAATCATCTTTAGTCCAGGACTAAAGATGATCTTTAGTCCCCGTTCATGTCGTGTCAGAGGCTGCTAGTCCCTAG

Reverse complement sequence

CTAGGGACTAGCAGCCTCTGACACGACATGAACGGGGACTAAAGATCATCTTTAGTCCTGGACTAAAGATGATTTTTAGTCTCGGTTGATAACACGAACC[G/A]
GGATTAAAGATGATATAGTCCCCTTACAGTTATAAACCGGGACTAAAAATGTTTTTTTAGTCCCGGTTTTTAATGGAACCGAGACTATTGTGGATTTGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	9.20%	1.10%	9.16%	NA
All Indica	2759	82.50%	13.60%	1.23%	2.65%	NA
All Japonica	1512	72.60%	3.10%	1.06%	23.21%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	87.30%	9.90%	0.65%	2.15%	NA
Indica III	913	64.70%	27.80%	2.41%	5.04%	NA
Indica Intermediate	786	87.20%	9.50%	1.15%	2.16%	NA
Temperate Japonica	767	88.40%	0.30%	0.78%	10.56%	NA
Tropical Japonica	504	55.00%	5.60%	1.39%	38.10%	NA
Japonica Intermediate	241	59.30%	7.10%	1.24%	32.37%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	12.20%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501764750	C -> T	LOC_Os05g03940.1	upstream_gene_variant ; 1933.0bp to feature; MODIFIER	silent_mutation	Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N
vg0501764750	C -> T	LOC_Os05g03934.1	downstream_gene_variant ; 1994.0bp to feature; MODIFIER	silent_mutation	Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N
vg0501764750	C -> T	LOC_Os05g03934-LOC_Os05g03940	intergenic_region ; MODIFIER	silent_mutation	Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N
vg0501764750	C -> DEL	N	N	silent_mutation	Average:52.65; most accessible tissue: Minghui63 young leaf, score: 76.385	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501764750	NA	4.93E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	NA	9.27E-06	mr1401	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	4.64E-06	4.64E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	4.47E-06	4.47E-06	mr1663_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	9.18E-06	9.18E-06	mr1669_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	4.01E-06	4.01E-06	mr1688_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	9.21E-06	9.21E-06	mr1697_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	NA	1.74E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501764750	5.00E-06	3.54E-08	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251