\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501751502:

Variant ID: vg0501751502 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1751502
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGACCGTCCGTTTTATTTGAAAAAATTATAAAAAAATTAAAAAAACAAGTCACGCATAAAATATTAATCATGTTTTATCATCTAACAACAATAAAATTA[T/C]
GAATTATAAAAAAAATTTATATAAGACGGACAGTTAAAGTTAGACATAAAAACCCAGGGTTTACCTTTTTTTGGAACGGAGGGAGTAGTAATTAAGCCAG

Reverse complement sequence

CTGGCTTAATTACTACTCCCTCCGTTCCAAAAAAAGGTAAACCCTGGGTTTTTATGTCTAACTTTAACTGTCCGTCTTATATAAATTTTTTTTATAATTC[A/G]
TAATTTTATTGTTGTTAGATGATAAAACATGATTAATATTTTATGCGTGACTTGTTTTTTTAATTTTTTTATAATTTTTTCAAATAAAACGGACGGTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 22.00% 0.19% 6.43% NA
All Indica  2759 98.00% 0.90% 0.04% 1.09% NA
All Japonica  1512 33.90% 64.20% 0.46% 1.46% NA
Aus  269 10.80% 0.00% 0.37% 88.85% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.50% 1.90% 0.00% 2.58% NA
Indica III  913 98.50% 1.10% 0.00% 0.44% NA
Indica Intermediate  786 97.50% 0.60% 0.13% 1.78% NA
Temperate Japonica  767 13.80% 85.00% 0.65% 0.52% NA
Tropical Japonica  504 58.50% 38.10% 0.20% 3.17% NA
Japonica Intermediate  241 46.10% 52.70% 0.41% 0.83% NA
VI/Aromatic  96 75.00% 16.70% 0.00% 8.33% NA
Intermediate  90 65.60% 28.90% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501751502 T -> DEL N N silent_mutation Average:80.461; most accessible tissue: Minghui63 young leaf, score: 99.609 N N N N
vg0501751502 T -> C LOC_Os05g03910.1 upstream_gene_variant ; 2652.0bp to feature; MODIFIER silent_mutation Average:80.461; most accessible tissue: Minghui63 young leaf, score: 99.609 N N N N
vg0501751502 T -> C LOC_Os05g03920.1 upstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:80.461; most accessible tissue: Minghui63 young leaf, score: 99.609 N N N N
vg0501751502 T -> C LOC_Os05g03910-LOC_Os05g03920 intergenic_region ; MODIFIER silent_mutation Average:80.461; most accessible tissue: Minghui63 young leaf, score: 99.609 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0501751502 T C -0.01 0.0 0.0 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501751502 NA 2.03E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 2.53E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 9.63E-10 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 1.08E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 4.22E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 6.11E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 3.07E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 1.30E-06 1.30E-06 mr1542_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501751502 NA 1.19E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251