Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0501722287:

Variant ID: vg0501722287 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 1722287
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACCACAAGTGCTGCGAGTGCTAACTAGGGAGAAGGGAAAATATTCTCTATATTAGTTGCATGTCTTGTGCCTTAGCCCAGAAGCTATTTGCACGTCGT[A/C]
TGCTGCGCGGGGCCCATCAAATCATGCAGGGCGCCCTTGTCATTCGCCATTCAATGGATGAGGACTTCCGGGTTCCCGTTCGCACCAGGAAACGGGAACC

Reverse complement sequence

GGTTCCCGTTTCCTGGTGCGAACGGGAACCCGGAAGTCCTCATCCATTGAATGGCGAATGACAAGGGCGCCCTGCATGATTTGATGGGCCCCGCGCAGCA[T/G]
ACGACGTGCAAATAGCTTCTGGGCTAAGGCACAAGACATGCAACTAATATAGAGAATATTTTCCCTTCTCCCTAGTTAGCACTCGCAGCACTTGTGGTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.30%	2.80%	1.06%	62.91%	NA
All Indica	2759	3.00%	1.00%	1.56%	94.45%	NA
All Japonica	1512	94.40%	0.70%	0.07%	4.83%	NA
Aus	269	0.70%	2.20%	1.86%	95.17%	NA
Indica I	595	2.50%	0.20%	1.01%	96.30%	NA
Indica II	465	4.70%	0.90%	2.80%	91.61%	NA
Indica III	913	1.60%	1.50%	1.10%	95.73%	NA
Indica Intermediate	786	3.90%	1.00%	1.78%	93.26%	NA
Temperate Japonica	767	97.90%	0.70%	0.00%	1.43%	NA
Tropical Japonica	504	93.50%	0.20%	0.20%	6.15%	NA
Japonica Intermediate	241	85.50%	1.70%	0.00%	12.86%	NA
VI/Aromatic	96	4.20%	85.40%	0.00%	10.42%	NA
Intermediate	90	61.10%	6.70%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0501722287	A -> DEL	N	N	silent_mutation	Average:17.042; most accessible tissue: Callus, score: 67.707	N	N	N	N
vg0501722287	A -> C	LOC_Os05g03860.1	downstream_gene_variant ; 3129.0bp to feature; MODIFIER	silent_mutation	Average:17.042; most accessible tissue: Callus, score: 67.707	N	N	N	N
vg0501722287	A -> C	LOC_Os05g03865.1	downstream_gene_variant ; 3578.0bp to feature; MODIFIER	silent_mutation	Average:17.042; most accessible tissue: Callus, score: 67.707	N	N	N	N
vg0501722287	A -> C	LOC_Os05g03870.1	downstream_gene_variant ; 1063.0bp to feature; MODIFIER	silent_mutation	Average:17.042; most accessible tissue: Callus, score: 67.707	N	N	N	N
vg0501722287	A -> C	LOC_Os05g03884.1	downstream_gene_variant ; 2165.0bp to feature; MODIFIER	silent_mutation	Average:17.042; most accessible tissue: Callus, score: 67.707	N	N	N	N
vg0501722287	A -> C	LOC_Os05g03870-LOC_Os05g03884	intergenic_region ; MODIFIER	silent_mutation	Average:17.042; most accessible tissue: Callus, score: 67.707	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0501722287	NA	5.85E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	NA	5.97E-06	mr1107	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	7.25E-06	1.35E-06	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	6.47E-06	5.51E-07	mr1252	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	NA	8.45E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	NA	4.01E-06	mr1437	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	NA	4.22E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501722287	8.85E-08	2.52E-07	mr1544_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251