\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0501612224:

Variant ID: vg0501612224 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 1612224
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCTCCCTCCGCGAGGGATCACGGCGGGGAGGAGTTGGAGAGTTGCGGCGGCGGTGACGAGGGTCGTGGCTCTCGCTAGCATCCTCACTCCCAGACGGA[G/C]
TGGGGGTGAACACCACCACCTCCTCCTCCAGGACCTCGACCATGATCGTCGAGGGTCATGGGAAACTTGGGACGGAAGGCGACGACTTCTCTTTAAAGCG

Reverse complement sequence

CGCTTTAAAGAGAAGTCGTCGCCTTCCGTCCCAAGTTTCCCATGACCCTCGACGATCATGGTCGAGGTCCTGGAGGAGGAGGTGGTGGTGTTCACCCCCA[C/G]
TCCGTCTGGGAGTGAGGATGCTAGCGAGAGCCACGACCCTCGTCACCGCCGCCGCAACTCTCCAACTCCTCCCCGCCGTGATCCCTCGCGGAGGGAGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 46.60% 1.78% 2.64% NA
All Indica  2759 82.10% 10.30% 3.04% 4.53% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 83.00% 3.70% 7.06% 6.22% NA
Indica II  465 86.20% 8.80% 2.15% 2.80% NA
Indica III  913 77.20% 15.40% 1.86% 5.48% NA
Indica Intermediate  786 84.60% 10.30% 1.91% 3.18% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0501612224 G -> DEL N N silent_mutation Average:46.554; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0501612224 G -> C LOC_Os05g03690.1 downstream_gene_variant ; 3284.0bp to feature; MODIFIER silent_mutation Average:46.554; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0501612224 G -> C LOC_Os05g03700.1 downstream_gene_variant ; 4890.0bp to feature; MODIFIER silent_mutation Average:46.554; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0501612224 G -> C LOC_Os05g03690-LOC_Os05g03700 intergenic_region ; MODIFIER silent_mutation Average:46.554; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0501612224 NA 5.75E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 6.25E-07 5.45E-08 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 4.60E-34 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 1.55E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 2.41E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 1.37E-16 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 2.07E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 6.04E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 1.13E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 1.57E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 6.48E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 4.20E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 1.43E-06 4.01E-07 mr1247_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 3.89E-50 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 1.20E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 4.71E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 3.37E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0501612224 NA 2.11E-61 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251